Incidental Mutation 'R6116:Neurod6'
ID485114
Institutional Source Beutler Lab
Gene Symbol Neurod6
Ensembl Gene ENSMUSG00000037984
Gene Nameneurogenic differentiation 6
SynonymsAtoh2, Nex, Math2, Nex1m, bHLHa2, Math-2
MMRRC Submission 044265-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6116 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location55677822-55681263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55678791 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 287 (Y287C)
Ref Sequence ENSEMBL: ENSMUSP00000047016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044767]
Predicted Effect probably damaging
Transcript: ENSMUST00000044767
AA Change: Y287C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047016
Gene: ENSMUSG00000037984
AA Change: Y287C

DomainStartEndE-ValueType
low complexity region 54 70 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
HLH 100 152 6.35e-17 SMART
Pfam:Neuro_bHLH 153 272 2.8e-42 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the NEUROD family of basic helix-loop-helix transcription factors. The encoded protein may be involved in the development and differentiation of the nervous system. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile and exhibit an apparently normal differentiation of CNS neurons with no obvious behavioral or motor abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T A 19: 9,012,963 probably benign Het
Apc A T 18: 34,316,455 I2101F probably damaging Het
Bpifa3 G A 2: 154,133,713 V68I possibly damaging Het
Csmd1 T A 8: 16,211,850 I878F probably damaging Het
Cyp2c67 A T 19: 39,617,435 M339K probably damaging Het
Dock3 A G 9: 106,931,962 Y1321H probably damaging Het
Dsc1 G T 18: 20,097,299 D316E probably benign Het
Eno3 C T 11: 70,661,575 T351M possibly damaging Het
Erbb2 T A 11: 98,427,399 F487Y probably damaging Het
Exosc10 T C 4: 148,573,353 L652P probably benign Het
Glmn A T 5: 107,557,340 M470K probably damaging Het
Gm15446 T A 5: 109,943,036 C385S probably damaging Het
Gm597 G A 1: 28,778,699 A84V probably benign Het
Hspa8 A G 9: 40,804,975 E581G probably damaging Het
Igfn1 T C 1: 135,970,467 D787G probably benign Het
Igkv12-44 T C 6: 69,814,854 T42A possibly damaging Het
Itsn2 T C 12: 4,629,939 probably benign Het
Jade2 T C 11: 51,835,633 E84G probably damaging Het
Lpar3 T A 3: 146,240,597 M10K possibly damaging Het
Lpin2 A G 17: 71,243,930 D695G probably damaging Het
Mosmo T A 7: 120,726,195 L7H probably damaging Het
Ms4a8a C T 19: 11,081,072 A9T unknown Het
Myb T C 10: 21,154,754 D48G probably damaging Het
Olfr878 A G 9: 37,918,659 M1V probably null Het
Olfr96 A G 17: 37,225,568 T148A probably benign Het
Olr1 T A 6: 129,499,984 D106V probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Ppfia3 T C 7: 45,354,703 Y505C probably damaging Het
Sdk2 T A 11: 113,854,364 I702F probably damaging Het
Slc16a11 T C 11: 70,215,436 F119L probably benign Het
Slc2a10 A C 2: 165,517,703 T496P probably damaging Het
Slc7a2 T C 8: 40,900,169 Y181H probably damaging Het
Stab2 G T 10: 86,907,190 P1185Q probably damaging Het
Tcf7l2 T A 19: 55,919,014 S335R probably damaging Het
Ttc41 G A 10: 86,759,088 probably null Het
Vmn2r32 A T 7: 7,464,093 I812N probably damaging Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Other mutations in Neurod6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03087:Neurod6 APN 6 55678775 nonsense probably null
R0446:Neurod6 UTSW 6 55679629 missense probably benign 0.17
R0540:Neurod6 UTSW 6 55679587 missense probably benign
R0607:Neurod6 UTSW 6 55679587 missense probably benign
R1752:Neurod6 UTSW 6 55679526 missense probably benign 0.00
R2078:Neurod6 UTSW 6 55678969 missense probably benign 0.00
R2317:Neurod6 UTSW 6 55678921 missense probably damaging 1.00
R4379:Neurod6 UTSW 6 55679272 missense probably damaging 0.99
R4807:Neurod6 UTSW 6 55678655 missense probably damaging 1.00
R5952:Neurod6 UTSW 6 55679017 missense probably damaging 0.99
R7391:Neurod6 UTSW 6 55679631 missense probably damaging 0.99
R7418:Neurod6 UTSW 6 55679298 missense probably damaging 1.00
Z1088:Neurod6 UTSW 6 55679362 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTGTGCCAATTACGCAGCC -3'
(R):5'- GTCCATGAAACCCTACAATTACTG -3'

Sequencing Primer
(F):5'- GCATCTGCTTTGCCTTAATTAGAG -3'
(R):5'- CCCTACAATTACTGCAGTGCATATG -3'
Posted On2017-08-16