Incidental Mutation 'R6116:Olr1'
ID485116
Institutional Source Beutler Lab
Gene Symbol Olr1
Ensembl Gene ENSMUSG00000030162
Gene Nameoxidized low density lipoprotein (lectin-like) receptor 1
SynonymsLOX-1, Scare1, SR-EI
MMRRC Submission 044265-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6116 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location129485244-129507165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129499984 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 106 (D106V)
Ref Sequence ENSEMBL: ENSMUSP00000032265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032265] [ENSMUST00000162815] [ENSMUST00000182784] [ENSMUST00000183258]
Predicted Effect probably damaging
Transcript: ENSMUST00000032265
AA Change: D106V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032265
Gene: ENSMUSG00000030162
AA Change: D106V

DomainStartEndE-ValueType
Blast:CLECT 45 186 4e-13 BLAST
low complexity region 202 226 N/A INTRINSIC
CLECT 235 355 3.83e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162815
AA Change: D72V

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124660
Gene: ENSMUSG00000030162
AA Change: D72V

DomainStartEndE-ValueType
Blast:CLECT 24 75 1e-8 BLAST
low complexity region 76 97 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182784
SMART Domains Protein: ENSMUSP00000138588
Gene: ENSMUSG00000030162

DomainStartEndE-ValueType
CLECT 61 181 3.83e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183258
SMART Domains Protein: ENSMUSP00000138228
Gene: ENSMUSG00000030162

DomainStartEndE-ValueType
CLECT 27 147 3.83e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203564
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a low density lipoprotein receptor that belongs to the C-type lectin superfamily. This gene is regulated through the cyclic AMP signaling pathway. The encoded protein binds, internalizes and degrades oxidized low-density lipoprotein. This protein may be involved in the regulation of Fas-induced apoptosis. This protein may play a role as a scavenger receptor. Mutations of this gene have been associated with atherosclerosis, risk of myocardial infarction, and may modify the risk of Alzheimer's disease. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mutation of this gene results in no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T A 19: 9,012,963 probably benign Het
Apc A T 18: 34,316,455 I2101F probably damaging Het
Bpifa3 G A 2: 154,133,713 V68I possibly damaging Het
Csmd1 T A 8: 16,211,850 I878F probably damaging Het
Cyp2c67 A T 19: 39,617,435 M339K probably damaging Het
Dock3 A G 9: 106,931,962 Y1321H probably damaging Het
Dsc1 G T 18: 20,097,299 D316E probably benign Het
Eno3 C T 11: 70,661,575 T351M possibly damaging Het
Erbb2 T A 11: 98,427,399 F487Y probably damaging Het
Exosc10 T C 4: 148,573,353 L652P probably benign Het
Glmn A T 5: 107,557,340 M470K probably damaging Het
Gm15446 T A 5: 109,943,036 C385S probably damaging Het
Gm597 G A 1: 28,778,699 A84V probably benign Het
Hspa8 A G 9: 40,804,975 E581G probably damaging Het
Igfn1 T C 1: 135,970,467 D787G probably benign Het
Igkv12-44 T C 6: 69,814,854 T42A possibly damaging Het
Itsn2 T C 12: 4,629,939 probably benign Het
Jade2 T C 11: 51,835,633 E84G probably damaging Het
Lpar3 T A 3: 146,240,597 M10K possibly damaging Het
Lpin2 A G 17: 71,243,930 D695G probably damaging Het
Mosmo T A 7: 120,726,195 L7H probably damaging Het
Ms4a8a C T 19: 11,081,072 A9T unknown Het
Myb T C 10: 21,154,754 D48G probably damaging Het
Neurod6 T C 6: 55,678,791 Y287C probably damaging Het
Olfr878 A G 9: 37,918,659 M1V probably null Het
Olfr96 A G 17: 37,225,568 T148A probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Ppfia3 T C 7: 45,354,703 Y505C probably damaging Het
Sdk2 T A 11: 113,854,364 I702F probably damaging Het
Slc16a11 T C 11: 70,215,436 F119L probably benign Het
Slc2a10 A C 2: 165,517,703 T496P probably damaging Het
Slc7a2 T C 8: 40,900,169 Y181H probably damaging Het
Stab2 G T 10: 86,907,190 P1185Q probably damaging Het
Tcf7l2 T A 19: 55,919,014 S335R probably damaging Het
Ttc41 G A 10: 86,759,088 probably null Het
Vmn2r32 A T 7: 7,464,093 I812N probably damaging Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Other mutations in Olr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Olr1 APN 6 129493523 missense probably benign 0.02
IGL01751:Olr1 APN 6 129488848 missense possibly damaging 0.62
IGL02308:Olr1 APN 6 129499897 missense possibly damaging 0.70
IGL03120:Olr1 APN 6 129488935 missense probably damaging 0.97
IGL03237:Olr1 APN 6 129502154 missense probably damaging 1.00
ANU74:Olr1 UTSW 6 129500069 missense possibly damaging 0.91
PIT4618001:Olr1 UTSW 6 129499906 missense probably damaging 0.99
R0112:Olr1 UTSW 6 129488906 missense possibly damaging 0.77
R1375:Olr1 UTSW 6 129507076 missense possibly damaging 0.94
R1650:Olr1 UTSW 6 129507089 missense probably benign 0.29
R1828:Olr1 UTSW 6 129488932 missense possibly damaging 0.94
R1971:Olr1 UTSW 6 129493535 missense probably benign 0.06
R2074:Olr1 UTSW 6 129502094 missense probably benign 0.23
R3110:Olr1 UTSW 6 129499918 missense possibly damaging 0.91
R3112:Olr1 UTSW 6 129499918 missense possibly damaging 0.91
R3735:Olr1 UTSW 6 129499875 unclassified probably benign
R3736:Olr1 UTSW 6 129499875 unclassified probably benign
R4200:Olr1 UTSW 6 129502105 missense probably damaging 0.98
R4780:Olr1 UTSW 6 129488876 missense probably damaging 0.99
R4801:Olr1 UTSW 6 129488090 missense possibly damaging 0.71
R4802:Olr1 UTSW 6 129488090 missense possibly damaging 0.71
R4856:Olr1 UTSW 6 129493596 nonsense probably null
R4929:Olr1 UTSW 6 129500081 missense probably damaging 1.00
R5148:Olr1 UTSW 6 129493609 missense probably benign 0.02
R5659:Olr1 UTSW 6 129500029 missense probably damaging 0.96
R6037:Olr1 UTSW 6 129493541 missense probably damaging 1.00
R6037:Olr1 UTSW 6 129493541 missense probably damaging 1.00
R6356:Olr1 UTSW 6 129493559 missense probably benign 0.22
R6676:Olr1 UTSW 6 129500077 unclassified probably null
R7001:Olr1 UTSW 6 129488111 missense probably damaging 1.00
R7056:Olr1 UTSW 6 129488941 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTATGCTTCCCCTGGGCTAG -3'
(R):5'- GCAGCAGGCTAGAATGACTC -3'

Sequencing Primer
(F):5'- AGGGCACTCTGAATATTTGGC -3'
(R):5'- CAGCAGGCTAGAATGACTCTTAATTC -3'
Posted On2017-08-16