Incidental Mutation 'R6116:Vmn2r32'
ID485117
Institutional Source Beutler Lab
Gene Symbol Vmn2r32
Ensembl Gene ENSMUSG00000096743
Gene Namevomeronasal 2, receptor 32
SynonymsV2r5
MMRRC Submission 044265-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R6116 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location7463015-7479973 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7464093 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 812 (I812N)
Ref Sequence ENSEMBL: ENSMUSP00000092462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094866]
Predicted Effect probably damaging
Transcript: ENSMUST00000094866
AA Change: I812N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092462
Gene: ENSMUSG00000096743
AA Change: I812N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 470 3.6e-33 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 9.5e-55 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T A 19: 9,012,963 probably benign Het
Apc A T 18: 34,316,455 I2101F probably damaging Het
Bpifa3 G A 2: 154,133,713 V68I possibly damaging Het
Csmd1 T A 8: 16,211,850 I878F probably damaging Het
Cyp2c67 A T 19: 39,617,435 M339K probably damaging Het
Dock3 A G 9: 106,931,962 Y1321H probably damaging Het
Dsc1 G T 18: 20,097,299 D316E probably benign Het
Eno3 C T 11: 70,661,575 T351M possibly damaging Het
Erbb2 T A 11: 98,427,399 F487Y probably damaging Het
Exosc10 T C 4: 148,573,353 L652P probably benign Het
Glmn A T 5: 107,557,340 M470K probably damaging Het
Gm15446 T A 5: 109,943,036 C385S probably damaging Het
Gm597 G A 1: 28,778,699 A84V probably benign Het
Hspa8 A G 9: 40,804,975 E581G probably damaging Het
Igfn1 T C 1: 135,970,467 D787G probably benign Het
Igkv12-44 T C 6: 69,814,854 T42A possibly damaging Het
Itsn2 T C 12: 4,629,939 probably benign Het
Jade2 T C 11: 51,835,633 E84G probably damaging Het
Lpar3 T A 3: 146,240,597 M10K possibly damaging Het
Lpin2 A G 17: 71,243,930 D695G probably damaging Het
Mosmo T A 7: 120,726,195 L7H probably damaging Het
Ms4a8a C T 19: 11,081,072 A9T unknown Het
Myb T C 10: 21,154,754 D48G probably damaging Het
Neurod6 T C 6: 55,678,791 Y287C probably damaging Het
Olfr878 A G 9: 37,918,659 M1V probably null Het
Olfr96 A G 17: 37,225,568 T148A probably benign Het
Olr1 T A 6: 129,499,984 D106V probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Ppfia3 T C 7: 45,354,703 Y505C probably damaging Het
Sdk2 T A 11: 113,854,364 I702F probably damaging Het
Slc16a11 T C 11: 70,215,436 F119L probably benign Het
Slc2a10 A C 2: 165,517,703 T496P probably damaging Het
Slc7a2 T C 8: 40,900,169 Y181H probably damaging Het
Stab2 G T 10: 86,907,190 P1185Q probably damaging Het
Tcf7l2 T A 19: 55,919,014 S335R probably damaging Het
Ttc41 G A 10: 86,759,088 probably null Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Other mutations in Vmn2r32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Vmn2r32 APN 7 7476697 missense probably damaging 0.97
IGL02333:Vmn2r32 APN 7 7464144 missense probably damaging 1.00
IGL02406:Vmn2r32 APN 7 7476710 missense probably benign
IGL02428:Vmn2r32 APN 7 7474284 missense probably benign 0.02
IGL02484:Vmn2r32 APN 7 7464117 missense probably damaging 1.00
IGL03277:Vmn2r32 APN 7 7474252 missense probably benign 0.23
IGL03366:Vmn2r32 APN 7 7464030 missense probably damaging 0.99
R1055:Vmn2r32 UTSW 7 7474327 nonsense probably null
R1695:Vmn2r32 UTSW 7 7463992 missense probably benign 0.01
R2172:Vmn2r32 UTSW 7 7474615 missense probably damaging 0.99
R2262:Vmn2r32 UTSW 7 7474619 missense probably benign
R3150:Vmn2r32 UTSW 7 7472555 missense probably benign
R4362:Vmn2r32 UTSW 7 7479858 nonsense probably null
R4432:Vmn2r32 UTSW 7 7479919 missense probably damaging 0.98
R4851:Vmn2r32 UTSW 7 7479954 missense possibly damaging 0.59
R4949:Vmn2r32 UTSW 7 7464084 missense probably benign 0.22
R5990:Vmn2r32 UTSW 7 7479810 missense probably damaging 0.97
R6083:Vmn2r32 UTSW 7 7464210 missense probably benign 0.15
R6084:Vmn2r32 UTSW 7 7464210 missense probably benign 0.15
R6263:Vmn2r32 UTSW 7 7476692 missense possibly damaging 0.90
R6889:Vmn2r32 UTSW 7 7472574 missense possibly damaging 0.82
R7286:Vmn2r32 UTSW 7 7479808 missense probably benign 0.21
R7390:Vmn2r32 UTSW 7 7479852 missense probably benign 0.00
R7412:Vmn2r32 UTSW 7 7474213 missense possibly damaging 0.53
R7508:Vmn2r32 UTSW 7 7467374 missense possibly damaging 0.87
Z1177:Vmn2r32 UTSW 7 7474161 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGAGCAACCAGTGAGAGTGATTC -3'
(R):5'- GTCCTTGGATACTTGGCCTG -3'

Sequencing Primer
(F):5'- CAACCAGTGAGAGTGATTCTAAAAC -3'
(R):5'- GATACTTGGCCTGCCTGG -3'
Posted On2017-08-16