Incidental Mutation 'R6116:Slc7a2'
ID485121
Institutional Source Beutler Lab
Gene Symbol Slc7a2
Ensembl Gene ENSMUSG00000031596
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 2
SynonymsTea, Cat2, Atrc2
MMRRC Submission 044265-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6116 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location40862396-40922308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40900169 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 181 (Y181H)
Ref Sequence ENSEMBL: ENSMUSP00000112848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057784] [ENSMUST00000098816] [ENSMUST00000117077] [ENSMUST00000118432] [ENSMUST00000141505]
Predicted Effect probably damaging
Transcript: ENSMUST00000057784
AA Change: Y164H

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058866
Gene: ENSMUSG00000031596
AA Change: Y164H

DomainStartEndE-ValueType
Pfam:AA_permease_2 34 450 1.4e-55 PFAM
Pfam:AA_permease 38 442 9.7e-38 PFAM
transmembrane domain 492 514 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:AA_permease_C 555 605 4.2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098816
AA Change: Y164H

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096414
Gene: ENSMUSG00000031596
AA Change: Y164H

DomainStartEndE-ValueType
Pfam:AA_permease_2 34 451 8.9e-54 PFAM
Pfam:AA_permease 38 443 5.8e-35 PFAM
transmembrane domain 493 515 N/A INTRINSIC
transmembrane domain 525 544 N/A INTRINSIC
Pfam:AA_permease_C 556 606 4.1e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117077
AA Change: Y164H

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113729
Gene: ENSMUSG00000031596
AA Change: Y164H

DomainStartEndE-ValueType
Pfam:AA_permease_2 34 454 2e-52 PFAM
Pfam:AA_permease 38 440 4.8e-33 PFAM
transmembrane domain 493 515 N/A INTRINSIC
transmembrane domain 525 544 N/A INTRINSIC
Pfam:AA_permease_C 556 606 3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118432
AA Change: Y181H

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112848
Gene: ENSMUSG00000031596
AA Change: Y181H

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:AA_permease_2 51 469 5.1e-54 PFAM
Pfam:AA_permease 55 456 5.1e-36 PFAM
transmembrane domain 509 531 N/A INTRINSIC
transmembrane domain 541 560 N/A INTRINSIC
Pfam:AA_permease_C 572 622 2.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141505
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cationic amino acid transporter and a member of the APC (amino acid-polyamine-organocation) family of transporters. The encoded membrane protein is responsible for the cellular uptake of arginine, lysine and ornithine. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygotes for a targeted null allele exhibit a marked reduction of nitric oxide production by cytokine-activated macrophages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T A 19: 9,012,963 probably benign Het
Apc A T 18: 34,316,455 I2101F probably damaging Het
Bpifa3 G A 2: 154,133,713 V68I possibly damaging Het
Csmd1 T A 8: 16,211,850 I878F probably damaging Het
Cyp2c67 A T 19: 39,617,435 M339K probably damaging Het
Dock3 A G 9: 106,931,962 Y1321H probably damaging Het
Dsc1 G T 18: 20,097,299 D316E probably benign Het
Eno3 C T 11: 70,661,575 T351M possibly damaging Het
Erbb2 T A 11: 98,427,399 F487Y probably damaging Het
Exosc10 T C 4: 148,573,353 L652P probably benign Het
Glmn A T 5: 107,557,340 M470K probably damaging Het
Gm15446 T A 5: 109,943,036 C385S probably damaging Het
Gm597 G A 1: 28,778,699 A84V probably benign Het
Hspa8 A G 9: 40,804,975 E581G probably damaging Het
Igfn1 T C 1: 135,970,467 D787G probably benign Het
Igkv12-44 T C 6: 69,814,854 T42A possibly damaging Het
Itsn2 T C 12: 4,629,939 probably benign Het
Jade2 T C 11: 51,835,633 E84G probably damaging Het
Lpar3 T A 3: 146,240,597 M10K possibly damaging Het
Lpin2 A G 17: 71,243,930 D695G probably damaging Het
Mosmo T A 7: 120,726,195 L7H probably damaging Het
Ms4a8a C T 19: 11,081,072 A9T unknown Het
Myb T C 10: 21,154,754 D48G probably damaging Het
Neurod6 T C 6: 55,678,791 Y287C probably damaging Het
Olfr878 A G 9: 37,918,659 M1V probably null Het
Olfr96 A G 17: 37,225,568 T148A probably benign Het
Olr1 T A 6: 129,499,984 D106V probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Ppfia3 T C 7: 45,354,703 Y505C probably damaging Het
Sdk2 T A 11: 113,854,364 I702F probably damaging Het
Slc16a11 T C 11: 70,215,436 F119L probably benign Het
Slc2a10 A C 2: 165,517,703 T496P probably damaging Het
Stab2 G T 10: 86,907,190 P1185Q probably damaging Het
Tcf7l2 T A 19: 55,919,014 S335R probably damaging Het
Ttc41 G A 10: 86,759,088 probably null Het
Vmn2r32 A T 7: 7,464,093 I812N probably damaging Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Other mutations in Slc7a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Slc7a2 APN 8 40905622 missense possibly damaging 0.57
IGL00948:Slc7a2 APN 8 40912524 missense probably benign 0.04
IGL01565:Slc7a2 APN 8 40899238 missense possibly damaging 0.94
IGL01590:Slc7a2 APN 8 40914100 missense probably damaging 1.00
IGL01939:Slc7a2 APN 8 40914083 missense possibly damaging 0.93
IGL02043:Slc7a2 APN 8 40911058 missense probably benign 0.35
IGL02101:Slc7a2 APN 8 40902594 missense probably benign 0.07
IGL02238:Slc7a2 APN 8 40908156 missense probably benign
IGL02385:Slc7a2 APN 8 40899011 missense probably damaging 0.98
IGL02562:Slc7a2 APN 8 40915020 missense probably damaging 1.00
IGL02962:Slc7a2 APN 8 40905584 missense probably damaging 0.98
IGL03268:Slc7a2 APN 8 40912517 missense probably benign 0.00
IGL03285:Slc7a2 APN 8 40914993 missense possibly damaging 0.50
IGL03345:Slc7a2 APN 8 40916493 missense probably benign 0.25
IGL03375:Slc7a2 APN 8 40916373 missense probably damaging 1.00
R0014:Slc7a2 UTSW 8 40911028 missense probably damaging 1.00
R0014:Slc7a2 UTSW 8 40911028 missense probably damaging 1.00
R0437:Slc7a2 UTSW 8 40904526 missense probably damaging 1.00
R0624:Slc7a2 UTSW 8 40908531 missense probably benign 0.34
R1406:Slc7a2 UTSW 8 40905585 missense probably damaging 1.00
R1406:Slc7a2 UTSW 8 40905585 missense probably damaging 1.00
R1908:Slc7a2 UTSW 8 40916497 missense probably benign
R1959:Slc7a2 UTSW 8 40914965 missense probably damaging 0.97
R2251:Slc7a2 UTSW 8 40905621 missense probably benign 0.19
R2252:Slc7a2 UTSW 8 40905621 missense probably benign 0.19
R2253:Slc7a2 UTSW 8 40905621 missense probably benign 0.19
R3498:Slc7a2 UTSW 8 40912530 missense probably benign 0.11
R3899:Slc7a2 UTSW 8 40905553 missense possibly damaging 0.93
R4440:Slc7a2 UTSW 8 40902649 missense probably benign
R4785:Slc7a2 UTSW 8 40911058 missense probably benign 0.18
R4788:Slc7a2 UTSW 8 40913986 missense probably benign
R4826:Slc7a2 UTSW 8 40911046 missense probably damaging 1.00
R4996:Slc7a2 UTSW 8 40912562 nonsense probably null
R5249:Slc7a2 UTSW 8 40908093 missense possibly damaging 0.77
R5314:Slc7a2 UTSW 8 40915030 critical splice donor site probably null
R5408:Slc7a2 UTSW 8 40915005 missense probably damaging 1.00
R5537:Slc7a2 UTSW 8 40913986 missense probably benign 0.10
R7139:Slc7a2 UTSW 8 40915013 missense probably benign 0.01
R7389:Slc7a2 UTSW 8 40912515 missense probably benign
R7451:Slc7a2 UTSW 8 40912649 missense probably damaging 0.99
X0062:Slc7a2 UTSW 8 40914963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTAAGCCAGGTTTCTCCAG -3'
(R):5'- TAAACGCTTACTCCGGGAGC -3'

Sequencing Primer
(F):5'- TAAGCCAGGTTTCTCCAGGAAGC -3'
(R):5'- ACTCCGGGAGCAATGGTTG -3'
Posted On2017-08-16