Incidental Mutation 'R6116:Olfr878'
ID485122
Institutional Source Beutler Lab
Gene Symbol Olfr878
Ensembl Gene ENSMUSG00000066747
Gene Nameolfactory receptor 878
SynonymsMOR163-1, GA_x6K02T2PVTD-31600511-31601440
MMRRC Submission 044265-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R6116 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location37917840-37922474 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 37918659 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000149519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086061] [ENSMUST00000212878] [ENSMUST00000214263] [ENSMUST00000216723]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086061
AA Change: M6V

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083228
Gene: ENSMUSG00000066747
AA Change: M6V

DomainStartEndE-ValueType
Pfam:7tm_4 36 312 1.4e-46 PFAM
Pfam:7tm_1 46 294 5.6e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000212878
AA Change: M1V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably null
Transcript: ENSMUST00000214263
AA Change: M1V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214813
Predicted Effect probably null
Transcript: ENSMUST00000216723
AA Change: M1V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T A 19: 9,012,963 probably benign Het
Apc A T 18: 34,316,455 I2101F probably damaging Het
Bpifa3 G A 2: 154,133,713 V68I possibly damaging Het
Csmd1 T A 8: 16,211,850 I878F probably damaging Het
Cyp2c67 A T 19: 39,617,435 M339K probably damaging Het
Dock3 A G 9: 106,931,962 Y1321H probably damaging Het
Dsc1 G T 18: 20,097,299 D316E probably benign Het
Eno3 C T 11: 70,661,575 T351M possibly damaging Het
Erbb2 T A 11: 98,427,399 F487Y probably damaging Het
Exosc10 T C 4: 148,573,353 L652P probably benign Het
Glmn A T 5: 107,557,340 M470K probably damaging Het
Gm15446 T A 5: 109,943,036 C385S probably damaging Het
Gm597 G A 1: 28,778,699 A84V probably benign Het
Hspa8 A G 9: 40,804,975 E581G probably damaging Het
Igfn1 T C 1: 135,970,467 D787G probably benign Het
Igkv12-44 T C 6: 69,814,854 T42A possibly damaging Het
Itsn2 T C 12: 4,629,939 probably benign Het
Jade2 T C 11: 51,835,633 E84G probably damaging Het
Lpar3 T A 3: 146,240,597 M10K possibly damaging Het
Lpin2 A G 17: 71,243,930 D695G probably damaging Het
Mosmo T A 7: 120,726,195 L7H probably damaging Het
Ms4a8a C T 19: 11,081,072 A9T unknown Het
Myb T C 10: 21,154,754 D48G probably damaging Het
Neurod6 T C 6: 55,678,791 Y287C probably damaging Het
Olfr96 A G 17: 37,225,568 T148A probably benign Het
Olr1 T A 6: 129,499,984 D106V probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Ppfia3 T C 7: 45,354,703 Y505C probably damaging Het
Sdk2 T A 11: 113,854,364 I702F probably damaging Het
Slc16a11 T C 11: 70,215,436 F119L probably benign Het
Slc2a10 A C 2: 165,517,703 T496P probably damaging Het
Slc7a2 T C 8: 40,900,169 Y181H probably damaging Het
Stab2 G T 10: 86,907,190 P1185Q probably damaging Het
Tcf7l2 T A 19: 55,919,014 S335R probably damaging Het
Ttc41 G A 10: 86,759,088 probably null Het
Vmn2r32 A T 7: 7,464,093 I812N probably damaging Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Other mutations in Olfr878
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Olfr878 APN 9 37919050 missense probably damaging 1.00
IGL01354:Olfr878 APN 9 37919544 missense possibly damaging 0.74
R0399:Olfr878 UTSW 9 37919553 missense possibly damaging 0.85
R1537:Olfr878 UTSW 9 37919274 missense probably benign 0.24
R3737:Olfr878 UTSW 9 37918641 splice site probably benign
R4035:Olfr878 UTSW 9 37918641 splice site probably benign
R4675:Olfr878 UTSW 9 37919586 makesense probably null
R4700:Olfr878 UTSW 9 37918921 missense possibly damaging 0.77
R5719:Olfr878 UTSW 9 37919351 missense probably damaging 1.00
R5824:Olfr878 UTSW 9 37919565 missense probably benign 0.00
R5940:Olfr878 UTSW 9 37919437 missense probably damaging 1.00
R6705:Olfr878 UTSW 9 37918784 missense probably damaging 1.00
R7075:Olfr878 UTSW 9 37919074 missense probably benign 0.09
R7470:Olfr878 UTSW 9 37919296 missense probably damaging 1.00
R8057:Olfr878 UTSW 9 37919164 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTATGCTCAGTCACACTATTAGTG -3'
(R):5'- TTTTGGCGTGAACACACAGG -3'

Sequencing Primer
(F):5'- CACTATTAGTGGCTTAAGATGAAGAG -3'
(R):5'- TTTTGGCGTGAACACACAGGAATAAC -3'
Posted On2017-08-16