Incidental Mutation 'R6116:Jade2'
ID485128
Institutional Source Beutler Lab
Gene Symbol Jade2
Ensembl Gene ENSMUSG00000020387
Gene Namejade family PHD finger 2
SynonymsPhf15, 1200017K05Rik
MMRRC Submission 044265-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6116 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location51813455-51857653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51835633 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 84 (E84G)
Ref Sequence ENSEMBL: ENSMUSP00000104718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020655] [ENSMUST00000109090] [ENSMUST00000109091]
Predicted Effect probably damaging
Transcript: ENSMUST00000020655
AA Change: E84G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020655
Gene: ENSMUSG00000020387
AA Change: E84G

DomainStartEndE-ValueType
Pfam:EPL1 39 177 3.4e-17 PFAM
PHD 201 247 1.35e-10 SMART
PHD 310 365 1.74e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109090
AA Change: E84G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104718
Gene: ENSMUSG00000020387
AA Change: E84G

DomainStartEndE-ValueType
Pfam:EPL1 39 177 2e-17 PFAM
PHD 201 247 1.35e-10 SMART
PHD 310 365 1.74e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109091
AA Change: E84G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104719
Gene: ENSMUSG00000020387
AA Change: E84G

DomainStartEndE-ValueType
Pfam:EPL1 2 176 9.6e-9 PFAM
PHD 201 247 1.35e-10 SMART
PHD 310 365 1.74e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T A 19: 9,012,963 probably benign Het
Apc A T 18: 34,316,455 I2101F probably damaging Het
Bpifa3 G A 2: 154,133,713 V68I possibly damaging Het
Csmd1 T A 8: 16,211,850 I878F probably damaging Het
Cyp2c67 A T 19: 39,617,435 M339K probably damaging Het
Dock3 A G 9: 106,931,962 Y1321H probably damaging Het
Dsc1 G T 18: 20,097,299 D316E probably benign Het
Eno3 C T 11: 70,661,575 T351M possibly damaging Het
Erbb2 T A 11: 98,427,399 F487Y probably damaging Het
Exosc10 T C 4: 148,573,353 L652P probably benign Het
Glmn A T 5: 107,557,340 M470K probably damaging Het
Gm15446 T A 5: 109,943,036 C385S probably damaging Het
Gm597 G A 1: 28,778,699 A84V probably benign Het
Hspa8 A G 9: 40,804,975 E581G probably damaging Het
Igfn1 T C 1: 135,970,467 D787G probably benign Het
Igkv12-44 T C 6: 69,814,854 T42A possibly damaging Het
Itsn2 T C 12: 4,629,939 probably benign Het
Lpar3 T A 3: 146,240,597 M10K possibly damaging Het
Lpin2 A G 17: 71,243,930 D695G probably damaging Het
Mosmo T A 7: 120,726,195 L7H probably damaging Het
Ms4a8a C T 19: 11,081,072 A9T unknown Het
Myb T C 10: 21,154,754 D48G probably damaging Het
Neurod6 T C 6: 55,678,791 Y287C probably damaging Het
Olfr878 A G 9: 37,918,659 M1V probably null Het
Olfr96 A G 17: 37,225,568 T148A probably benign Het
Olr1 T A 6: 129,499,984 D106V probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Ppfia3 T C 7: 45,354,703 Y505C probably damaging Het
Sdk2 T A 11: 113,854,364 I702F probably damaging Het
Slc16a11 T C 11: 70,215,436 F119L probably benign Het
Slc2a10 A C 2: 165,517,703 T496P probably damaging Het
Slc7a2 T C 8: 40,900,169 Y181H probably damaging Het
Stab2 G T 10: 86,907,190 P1185Q probably damaging Het
Tcf7l2 T A 19: 55,919,014 S335R probably damaging Het
Ttc41 G A 10: 86,759,088 probably null Het
Vmn2r32 A T 7: 7,464,093 I812N probably damaging Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Other mutations in Jade2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Jade2 APN 11 51825338 missense possibly damaging 0.95
IGL01935:Jade2 APN 11 51828384 missense possibly damaging 0.95
IGL02885:Jade2 APN 11 51831296 missense probably damaging 1.00
IGL02987:Jade2 APN 11 51830481 missense probably damaging 1.00
IGL02990:Jade2 APN 11 51831247 splice site probably benign
IGL03172:Jade2 APN 11 51825371 missense probably damaging 1.00
R0116:Jade2 UTSW 11 51831309 missense probably damaging 1.00
R1917:Jade2 UTSW 11 51818538 missense possibly damaging 0.95
R3410:Jade2 UTSW 11 51817223 missense probably benign
R3886:Jade2 UTSW 11 51830499 missense possibly damaging 0.79
R4846:Jade2 UTSW 11 51821148 missense probably benign
R4916:Jade2 UTSW 11 51817082 missense probably benign 0.01
R5420:Jade2 UTSW 11 51818607 missense probably benign 0.21
R5446:Jade2 UTSW 11 51816959 missense probably benign
R5657:Jade2 UTSW 11 51816987 missense probably damaging 1.00
R6031:Jade2 UTSW 11 51826586 nonsense probably null
R6031:Jade2 UTSW 11 51826586 nonsense probably null
R7039:Jade2 UTSW 11 51828359 missense probably damaging 0.97
R7270:Jade2 UTSW 11 51817184 missense possibly damaging 0.89
R7702:Jade2 UTSW 11 51816917 missense probably damaging 1.00
R7797:Jade2 UTSW 11 51817299 missense probably benign 0.00
R8054:Jade2 UTSW 11 51818614 missense probably benign 0.00
R8243:Jade2 UTSW 11 51817218 missense probably benign
Z1177:Jade2 UTSW 11 51816990 missense probably damaging 0.96
Z1177:Jade2 UTSW 11 51848994 missense probably null 0.20
Predicted Primers PCR Primer
(F):5'- CCCAAAGCCTCATGGGTAAGTAA -3'
(R):5'- TGCTCCTCTGGCCTACGAA -3'

Sequencing Primer
(F):5'- GTTGTTCGGCAAGAGAATTAACCAC -3'
(R):5'- AAGCCGTCCTCTCTGAAGC -3'
Posted On2017-08-16