Incidental Mutation 'R6116:Slc16a11'
ID485129
Institutional Source Beutler Lab
Gene Symbol Slc16a11
Ensembl Gene ENSMUSG00000040938
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 11
SynonymsMNCb-2717
MMRRC Submission 044265-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6116 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location70212752-70216417 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70215436 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 119 (F119L)
Ref Sequence ENSEMBL: ENSMUSP00000115212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060010] [ENSMUST00000094055] [ENSMUST00000123716] [ENSMUST00000126296] [ENSMUST00000126388] [ENSMUST00000136328] [ENSMUST00000141290] [ENSMUST00000153993] [ENSMUST00000159867] [ENSMUST00000171032] [ENSMUST00000190533]
Predicted Effect probably benign
Transcript: ENSMUST00000060010
SMART Domains Protein: ENSMUSP00000053218
Gene: ENSMUSG00000044367

DomainStartEndE-ValueType
Pfam:MFS_1 14 277 1.7e-22 PFAM
Pfam:MFS_1 219 423 6.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094055
AA Change: F167L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000091597
Gene: ENSMUSG00000040938
AA Change: F167L

DomainStartEndE-ValueType
Pfam:MFS_1 17 340 5.5e-24 PFAM
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
low complexity region 407 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122852
Predicted Effect probably benign
Transcript: ENSMUST00000123716
SMART Domains Protein: ENSMUSP00000114871
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126296
AA Change: F167L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000118381
Gene: ENSMUSG00000040938
AA Change: F167L

DomainStartEndE-ValueType
Pfam:MFS_1 16 196 2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126388
AA Change: F167L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000116648
Gene: ENSMUSG00000040938
AA Change: F167L

DomainStartEndE-ValueType
Pfam:MFS_1 17 340 5.5e-24 PFAM
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
low complexity region 407 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131468
Predicted Effect probably benign
Transcript: ENSMUST00000136328
AA Change: F119L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000115212
Gene: ENSMUSG00000040938
AA Change: F119L

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:MFS_1 66 297 8.3e-10 PFAM
low complexity region 306 324 N/A INTRINSIC
transmembrane domain 332 354 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141290
SMART Domains Protein: ENSMUSP00000116316
Gene: ENSMUSG00000044367

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149880
Predicted Effect probably benign
Transcript: ENSMUST00000153993
SMART Domains Protein: ENSMUSP00000122586
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 56 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159867
SMART Domains Protein: ENSMUSP00000124687
Gene: ENSMUSG00000044367

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171032
AA Change: F167L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128419
Gene: ENSMUSG00000040938
AA Change: F167L

DomainStartEndE-ValueType
Pfam:MFS_1 17 316 1.8e-24 PFAM
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
low complexity region 407 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190533
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T A 19: 9,012,963 probably benign Het
Apc A T 18: 34,316,455 I2101F probably damaging Het
Bpifa3 G A 2: 154,133,713 V68I possibly damaging Het
Csmd1 T A 8: 16,211,850 I878F probably damaging Het
Cyp2c67 A T 19: 39,617,435 M339K probably damaging Het
Dock3 A G 9: 106,931,962 Y1321H probably damaging Het
Dsc1 G T 18: 20,097,299 D316E probably benign Het
Eno3 C T 11: 70,661,575 T351M possibly damaging Het
Erbb2 T A 11: 98,427,399 F487Y probably damaging Het
Exosc10 T C 4: 148,573,353 L652P probably benign Het
Glmn A T 5: 107,557,340 M470K probably damaging Het
Gm15446 T A 5: 109,943,036 C385S probably damaging Het
Gm597 G A 1: 28,778,699 A84V probably benign Het
Hspa8 A G 9: 40,804,975 E581G probably damaging Het
Igfn1 T C 1: 135,970,467 D787G probably benign Het
Igkv12-44 T C 6: 69,814,854 T42A possibly damaging Het
Itsn2 T C 12: 4,629,939 probably benign Het
Jade2 T C 11: 51,835,633 E84G probably damaging Het
Lpar3 T A 3: 146,240,597 M10K possibly damaging Het
Lpin2 A G 17: 71,243,930 D695G probably damaging Het
Mosmo T A 7: 120,726,195 L7H probably damaging Het
Ms4a8a C T 19: 11,081,072 A9T unknown Het
Myb T C 10: 21,154,754 D48G probably damaging Het
Neurod6 T C 6: 55,678,791 Y287C probably damaging Het
Olfr878 A G 9: 37,918,659 M1V probably null Het
Olfr96 A G 17: 37,225,568 T148A probably benign Het
Olr1 T A 6: 129,499,984 D106V probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Ppfia3 T C 7: 45,354,703 Y505C probably damaging Het
Sdk2 T A 11: 113,854,364 I702F probably damaging Het
Slc2a10 A C 2: 165,517,703 T496P probably damaging Het
Slc7a2 T C 8: 40,900,169 Y181H probably damaging Het
Stab2 G T 10: 86,907,190 P1185Q probably damaging Het
Tcf7l2 T A 19: 55,919,014 S335R probably damaging Het
Ttc41 G A 10: 86,759,088 probably null Het
Vmn2r32 A T 7: 7,464,093 I812N probably damaging Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Other mutations in Slc16a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02678:Slc16a11 APN 11 70215416 missense probably damaging 0.99
shanxi UTSW 11 70215651 nonsense probably null
taihang UTSW 11 70215734 unclassified probably null
R0619:Slc16a11 UTSW 11 70215032 missense probably damaging 1.00
R2044:Slc16a11 UTSW 11 70215651 nonsense probably null
R2110:Slc16a11 UTSW 11 70215320 missense probably damaging 1.00
R4408:Slc16a11 UTSW 11 70215734 unclassified probably null
R4633:Slc16a11 UTSW 11 70216379 unclassified probably null
R5255:Slc16a11 UTSW 11 70215432 missense probably damaging 1.00
R5544:Slc16a11 UTSW 11 70215000 unclassified probably null
R5901:Slc16a11 UTSW 11 70216346 missense probably benign 0.02
R6993:Slc16a11 UTSW 11 70216016 missense possibly damaging 0.60
R7658:Slc16a11 UTSW 11 70215317 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTCCTATCCATTTGCAGGC -3'
(R):5'- CCTTGATCTAAAGCATGCGGAC -3'

Sequencing Primer
(F):5'- ATCCATTTGCAGGCTCTGG -3'
(R):5'- TCTAAAGCATGCGGACCCAAATG -3'
Posted On2017-08-16