Incidental Mutation 'R0521:Zfp442'
ID48514
Institutional Source Beutler Lab
Gene Symbol Zfp442
Ensembl Gene ENSMUSG00000068130
Gene Namezinc finger protein 442
SynonymsOTTMUSG00000015730
MMRRC Submission 038714-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0521 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location150407141-150451486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150411249 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 31 (D31G)
Ref Sequence ENSEMBL: ENSMUSP00000105542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109916] [ENSMUST00000185796]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109916
AA Change: D31G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105542
Gene: ENSMUSG00000068130
AA Change: D31G

DomainStartEndE-ValueType
KRAB 4 66 3.27e-19 SMART
ZnF_C2H2 159 181 8.34e-3 SMART
ZnF_C2H2 211 233 9.58e-3 SMART
ZnF_C2H2 239 261 2.43e-4 SMART
ZnF_C2H2 267 289 1.38e-3 SMART
ZnF_C2H2 295 317 4.17e-3 SMART
ZnF_C2H2 323 345 3.16e-3 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 2.09e-3 SMART
ZnF_C2H2 435 457 2.2e-2 SMART
ZnF_C2H2 463 485 1.6e-4 SMART
ZnF_C2H2 491 513 1.82e-3 SMART
ZnF_C2H2 519 541 4.47e-3 SMART
ZnF_C2H2 547 569 3.63e-3 SMART
ZnF_C2H2 575 597 4.79e-3 SMART
ZnF_C2H2 603 625 8.47e-4 SMART
ZnF_C2H2 631 654 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185796
AA Change: D30G

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140098
Gene: ENSMUSG00000068130
AA Change: D30G

DomainStartEndE-ValueType
KRAB 3 65 1.4e-21 SMART
ZnF_C2H2 158 180 3.4e-5 SMART
ZnF_C2H2 210 232 3.9e-5 SMART
ZnF_C2H2 238 260 1e-6 SMART
ZnF_C2H2 266 288 5.6e-6 SMART
ZnF_C2H2 294 316 1.8e-5 SMART
ZnF_C2H2 322 344 1.3e-5 SMART
ZnF_C2H2 350 372 6.7e-6 SMART
ZnF_C2H2 378 400 9.6e-5 SMART
ZnF_C2H2 406 428 6.9e-7 SMART
ZnF_C2H2 434 456 7.7e-6 SMART
ZnF_C2H2 462 484 1.9e-5 SMART
ZnF_C2H2 490 512 1.5e-5 SMART
ZnF_C2H2 518 540 2e-5 SMART
ZnF_C2H2 546 568 3.5e-6 SMART
ZnF_C2H2 574 597 1.3e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2900011O08Rik T A 16: 13,986,812 S8T possibly damaging Het
Aadacl3 A T 4: 144,455,894 S335T probably damaging Het
Abcb1b G A 5: 8,864,238 A1203T probably damaging Het
Agt C A 8: 124,557,100 E427* probably null Het
Angel1 G A 12: 86,722,907 S193F probably benign Het
Ankrd16 T C 2: 11,789,881 V359A probably benign Het
Ankrd33b T C 15: 31,367,286 D36G probably damaging Het
Ano8 A T 8: 71,479,258 C766S probably benign Het
Armc4 G A 18: 7,222,676 P531L possibly damaging Het
Asic1 C T 15: 99,698,819 R499C probably damaging Het
Bank1 C T 3: 136,213,942 C364Y probably damaging Het
Bpifa5 C A 2: 154,166,949 D223E probably benign Het
C87499 A T 4: 88,629,322 N37K probably damaging Het
Capn5 C T 7: 98,132,882 R217Q probably damaging Het
Ccm2 G A 11: 6,590,886 S184N probably damaging Het
Ces5a T A 8: 93,525,658 D202V probably damaging Het
Clasrp A G 7: 19,588,603 I284T probably benign Het
Cog7 C A 7: 121,941,169 probably null Het
Col13a1 A T 10: 61,862,746 M512K unknown Het
Cps1 A C 1: 67,215,564 D1304A probably benign Het
Crhbp C A 13: 95,443,895 probably null Het
Ctdspl2 T A 2: 122,006,887 C377* probably null Het
Ctsl G A 13: 64,365,218 L297F possibly damaging Het
Ddost A G 4: 138,310,735 T262A probably benign Het
Ddx4 A T 13: 112,624,779 probably null Het
Ddx54 A G 5: 120,626,862 I769V probably benign Het
Dock1 T A 7: 135,143,778 I1463N probably benign Het
Dsg3 T A 18: 20,527,815 Y404N possibly damaging Het
Epb42 T A 2: 121,029,150 K186* probably null Het
Fam173b T G 15: 31,605,957 S20R probably benign Het
Farp2 A G 1: 93,576,821 probably null Het
Fev C A 1: 74,882,533 R86L possibly damaging Het
Foxb2 G T 19: 16,872,456 C395* probably null Het
Foxn3 A G 12: 99,209,506 V261A probably benign Het
Fsd1 A G 17: 55,991,245 D190G probably benign Het
Gm9930 A T 10: 9,534,803 noncoding transcript Het
Gsdma2 A T 11: 98,654,901 K260* probably null Het
Hdac7 G A 15: 97,806,499 Q497* probably null Het
Hic1 G A 11: 75,166,887 P392L possibly damaging Het
Hk3 C T 13: 55,014,426 probably null Het
Ifna6 G T 4: 88,827,650 V79F probably benign Het
Il20ra A T 10: 19,759,640 Q543L probably damaging Het
Itk T A 11: 46,360,288 D163V probably damaging Het
Kcnu1 T G 8: 25,910,888 L688R probably damaging Het
Kdm5b T A 1: 134,618,033 S977R possibly damaging Het
Kng1 G A 16: 23,060,482 A45T possibly damaging Het
Lrrc29 A T 8: 105,312,793 L617Q probably damaging Het
Map1a T G 2: 121,305,753 L2350R probably damaging Het
Mdfic A G 6: 15,799,756 D212G probably benign Het
Ms4a1 C A 19: 11,258,679 probably null Het
Myo9a T A 9: 59,894,352 F1944L probably damaging Het
Nbea A T 3: 56,008,268 W928R probably damaging Het
Nfatc2ip T G 7: 126,396,579 D46A possibly damaging Het
Ngly1 C T 14: 16,290,774 Q419* probably null Het
Nsd2 T A 5: 33,843,338 N66K probably damaging Het
Nsmce4a T C 7: 130,537,002 H304R probably damaging Het
Olfr1099 C T 2: 86,958,846 G204D probably damaging Het
Olfr1239 T C 2: 89,418,200 Y71C probably damaging Het
Olfr1381 C T 11: 49,552,464 T239M probably damaging Het
Olfr624 T A 7: 103,670,489 I181F possibly damaging Het
Olfr714 T A 7: 107,074,758 L310Q possibly damaging Het
Olfr859 G A 9: 19,808,860 V181I probably benign Het
Olfr898 A C 9: 38,349,203 N40T probably damaging Het
Peg3 T C 7: 6,711,428 E265G probably damaging Het
Pkd1 A G 17: 24,595,219 S4188G probably benign Het
R3hdm1 G A 1: 128,193,703 V315I probably benign Het
Rab24 A T 13: 55,320,925 probably null Het
Rap1gap2 A T 11: 74,441,766 M71K probably damaging Het
Rergl T G 6: 139,496,526 K42T probably damaging Het
Sept5 T C 16: 18,624,897 T92A probably benign Het
Setdb1 A G 3: 95,338,829 V595A probably benign Het
Slc17a8 A G 10: 89,576,330 S414P probably benign Het
Thnsl2 A T 6: 71,134,259 D208E probably damaging Het
Tie1 A C 4: 118,476,146 I841R probably damaging Het
Tll1 T G 8: 64,098,471 D292A probably damaging Het
Tnfaip8l1 A T 17: 56,171,727 T6S probably damaging Het
Trim17 T A 11: 58,968,494 V178E probably damaging Het
Ttc27 A T 17: 74,856,549 R717S possibly damaging Het
Upk2 G T 9: 44,454,121 P50Q probably damaging Het
Usp9y A T Y: 1,307,880 C2319S probably benign Het
Vmn2r100 A T 17: 19,521,916 D184V probably damaging Het
Vmn2r9 C A 5: 108,848,288 G165* probably null Het
Xkr6 A T 14: 63,819,422 I261F probably benign Het
Xpnpep3 T G 15: 81,427,492 I133S possibly damaging Het
Yipf1 A G 4: 107,336,190 Y91C probably benign Het
Zfp628 A T 7: 4,919,940 Q387L probably damaging Het
Zfp804a C T 2: 82,259,417 Q1197* probably null Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Zfp442
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Zfp442 APN 2 150409347 nonsense probably null
IGL02566:Zfp442 APN 2 150409791 critical splice acceptor site probably null
IGL03217:Zfp442 APN 2 150409794 splice site probably benign
LCD18:Zfp442 UTSW 2 150419848 intron probably benign
PIT4812001:Zfp442 UTSW 2 150409741 nonsense probably null
R0219:Zfp442 UTSW 2 150411240 missense probably damaging 0.99
R1633:Zfp442 UTSW 2 150408340 nonsense probably null
R1702:Zfp442 UTSW 2 150409180 nonsense probably null
R1829:Zfp442 UTSW 2 150409063 missense probably damaging 0.99
R1868:Zfp442 UTSW 2 150408180 missense probably damaging 1.00
R1898:Zfp442 UTSW 2 150408662 missense probably damaging 1.00
R2030:Zfp442 UTSW 2 150408122 missense possibly damaging 0.58
R4676:Zfp442 UTSW 2 150409606 missense probably damaging 1.00
R4717:Zfp442 UTSW 2 150408229 missense probably damaging 1.00
R4894:Zfp442 UTSW 2 150411210 critical splice donor site probably null
R4932:Zfp442 UTSW 2 150409715 missense possibly damaging 0.53
R4963:Zfp442 UTSW 2 150408495 missense probably damaging 1.00
R5130:Zfp442 UTSW 2 150409610 missense possibly damaging 0.91
R5476:Zfp442 UTSW 2 150408159 missense probably damaging 1.00
R5986:Zfp442 UTSW 2 150408024 nonsense probably null
R6042:Zfp442 UTSW 2 150408096 missense probably damaging 0.97
R6383:Zfp442 UTSW 2 150451401 critical splice donor site probably null
R6452:Zfp442 UTSW 2 150408108 missense probably damaging 1.00
R6787:Zfp442 UTSW 2 150409579 missense possibly damaging 0.72
R6931:Zfp442 UTSW 2 150410940 critical splice donor site probably null
R7061:Zfp442 UTSW 2 150408017 missense probably benign 0.33
R7184:Zfp442 UTSW 2 150408136 missense possibly damaging 0.71
R7214:Zfp442 UTSW 2 150409281 missense probably benign 0.04
R7225:Zfp442 UTSW 2 150409005 missense probably benign 0.00
R7513:Zfp442 UTSW 2 150408756 missense unknown
R7591:Zfp442 UTSW 2 150408172 nonsense probably null
R7679:Zfp442 UTSW 2 150410997 nonsense probably null
R7768:Zfp442 UTSW 2 150408321 missense possibly damaging 0.53
R7801:Zfp442 UTSW 2 150409719 missense probably benign 0.28
R7814:Zfp442 UTSW 2 150409482 missense possibly damaging 0.92
R7848:Zfp442 UTSW 2 150411226 missense possibly damaging 0.71
R8158:Zfp442 UTSW 2 150409176 missense possibly damaging 0.83
R8192:Zfp442 UTSW 2 150408709 missense unknown
Z1177:Zfp442 UTSW 2 150408479 missense probably damaging 0.98
Predicted Primers
Posted On2013-06-12