Incidental Mutation 'R6116:Ms4a8a'
ID485140
Institutional Source Beutler Lab
Gene Symbol Ms4a8a
Ensembl Gene ENSMUSG00000024730
Gene Namemembrane-spanning 4-domains, subfamily A, member 8A
SynonymsCD20L5, Ms4a8, 2010004L09Rik
MMRRC Submission 044265-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6116 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location11067471-11081102 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 11081072 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 9 (A9T)
Ref Sequence ENSEMBL: ENSMUSP00000025636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025636]
Predicted Effect unknown
Transcript: ENSMUST00000025636
AA Change: A9T
SMART Domains Protein: ENSMUSP00000025636
Gene: ENSMUSG00000024730
AA Change: A9T

DomainStartEndE-ValueType
Pfam:CD20 109 247 3.7e-22 PFAM
low complexity region 266 284 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187859
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-spanning 4A gene family. Members of this protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. The gene encoding this protein is localized to 11q12.3, among a cluster of family members. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T A 19: 9,012,963 probably benign Het
Apc A T 18: 34,316,455 I2101F probably damaging Het
Bpifa3 G A 2: 154,133,713 V68I possibly damaging Het
Csmd1 T A 8: 16,211,850 I878F probably damaging Het
Cyp2c67 A T 19: 39,617,435 M339K probably damaging Het
Dock3 A G 9: 106,931,962 Y1321H probably damaging Het
Dsc1 G T 18: 20,097,299 D316E probably benign Het
Eno3 C T 11: 70,661,575 T351M possibly damaging Het
Erbb2 T A 11: 98,427,399 F487Y probably damaging Het
Exosc10 T C 4: 148,573,353 L652P probably benign Het
Glmn A T 5: 107,557,340 M470K probably damaging Het
Gm15446 T A 5: 109,943,036 C385S probably damaging Het
Gm597 G A 1: 28,778,699 A84V probably benign Het
Hspa8 A G 9: 40,804,975 E581G probably damaging Het
Igfn1 T C 1: 135,970,467 D787G probably benign Het
Igkv12-44 T C 6: 69,814,854 T42A possibly damaging Het
Itsn2 T C 12: 4,629,939 probably benign Het
Jade2 T C 11: 51,835,633 E84G probably damaging Het
Lpar3 T A 3: 146,240,597 M10K possibly damaging Het
Lpin2 A G 17: 71,243,930 D695G probably damaging Het
Mosmo T A 7: 120,726,195 L7H probably damaging Het
Myb T C 10: 21,154,754 D48G probably damaging Het
Neurod6 T C 6: 55,678,791 Y287C probably damaging Het
Olfr878 A G 9: 37,918,659 M1V probably null Het
Olfr96 A G 17: 37,225,568 T148A probably benign Het
Olr1 T A 6: 129,499,984 D106V probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Ppfia3 T C 7: 45,354,703 Y505C probably damaging Het
Sdk2 T A 11: 113,854,364 I702F probably damaging Het
Slc16a11 T C 11: 70,215,436 F119L probably benign Het
Slc2a10 A C 2: 165,517,703 T496P probably damaging Het
Slc7a2 T C 8: 40,900,169 Y181H probably damaging Het
Stab2 G T 10: 86,907,190 P1185Q probably damaging Het
Tcf7l2 T A 19: 55,919,014 S335R probably damaging Het
Ttc41 G A 10: 86,759,088 probably null Het
Vmn2r32 A T 7: 7,464,093 I812N probably damaging Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Other mutations in Ms4a8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Ms4a8a APN 19 11079444 missense probably benign 0.34
IGL00975:Ms4a8a APN 19 11070787 missense probably damaging 1.00
H8786:Ms4a8a UTSW 19 11076361 missense possibly damaging 0.61
R1084:Ms4a8a UTSW 19 11076362 missense probably damaging 1.00
R1586:Ms4a8a UTSW 19 11076332 missense possibly damaging 0.89
R1699:Ms4a8a UTSW 19 11076397 missense probably damaging 1.00
R5227:Ms4a8a UTSW 19 11068416 missense probably damaging 0.99
R5510:Ms4a8a UTSW 19 11079464 missense probably benign
R6819:Ms4a8a UTSW 19 11076379 missense probably damaging 1.00
R7470:Ms4a8a UTSW 19 11076350 missense possibly damaging 0.92
R7876:Ms4a8a UTSW 19 11079484 missense probably damaging 1.00
RF022:Ms4a8a UTSW 19 11076325 missense possibly damaging 0.89
Z1176:Ms4a8a UTSW 19 11070760 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GTGGGTCTCAGCATTAACCC -3'
(R):5'- CATTCAGGCACCTTGAAGCC -3'

Sequencing Primer
(F):5'- CATACCCAGTGAGTGGTATACC -3'
(R):5'- GCCCTTGACAAAATGAGCTG -3'
Posted On2017-08-16