Incidental Mutation 'R6116:Cyp2c67'
ID 485141
Institutional Source Beutler Lab
Gene Symbol Cyp2c67
Ensembl Gene ENSMUSG00000062624
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 67
Synonyms C730004C24Rik
MMRRC Submission 044265-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R6116 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 39597288-39637497 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 39605879 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 339 (M339K)
Ref Sequence ENSEMBL: ENSMUSP00000065796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067328]
AlphaFold Q569X9
Predicted Effect probably damaging
Transcript: ENSMUST00000067328
AA Change: M339K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065796
Gene: ENSMUSG00000062624
AA Change: M339K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 8.5e-150 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T A 19: 8,990,327 (GRCm39) probably benign Het
Apc A T 18: 34,449,508 (GRCm39) I2101F probably damaging Het
Bpifa3 G A 2: 153,975,633 (GRCm39) V68I possibly damaging Het
Csmd1 T A 8: 16,261,864 (GRCm39) I878F probably damaging Het
Dock3 A G 9: 106,809,161 (GRCm39) Y1321H probably damaging Het
Dsc1 G T 18: 20,230,356 (GRCm39) D316E probably benign Het
Eno3 C T 11: 70,552,401 (GRCm39) T351M possibly damaging Het
Erbb2 T A 11: 98,318,225 (GRCm39) F487Y probably damaging Het
Exosc10 T C 4: 148,657,810 (GRCm39) L652P probably benign Het
Glmn A T 5: 107,705,206 (GRCm39) M470K probably damaging Het
Gm15446 T A 5: 110,090,902 (GRCm39) C385S probably damaging Het
Hspa8 A G 9: 40,716,271 (GRCm39) E581G probably damaging Het
Igfn1 T C 1: 135,898,205 (GRCm39) D787G probably benign Het
Igkv12-44 T C 6: 69,791,838 (GRCm39) T42A possibly damaging Het
Itsn2 T C 12: 4,679,939 (GRCm39) probably benign Het
Jade2 T C 11: 51,726,460 (GRCm39) E84G probably damaging Het
Lpar3 T A 3: 145,946,352 (GRCm39) M10K possibly damaging Het
Lpin2 A G 17: 71,550,925 (GRCm39) D695G probably damaging Het
Mosmo T A 7: 120,325,418 (GRCm39) L7H probably damaging Het
Ms4a8a C T 19: 11,058,436 (GRCm39) A9T unknown Het
Myb T C 10: 21,030,653 (GRCm39) D48G probably damaging Het
Neurod6 T C 6: 55,655,776 (GRCm39) Y287C probably damaging Het
Olr1 T A 6: 129,476,947 (GRCm39) D106V probably damaging Het
Or11a4 A G 17: 37,536,459 (GRCm39) T148A probably benign Het
Or8b4 A G 9: 37,829,955 (GRCm39) M1V probably null Het
Peg10 C CCCATCAGGA 6: 4,756,351 (GRCm39) probably benign Het
Plch1 C T 3: 63,609,444 (GRCm39) R912H probably damaging Het
Ppfia3 T C 7: 45,004,127 (GRCm39) Y505C probably damaging Het
Sdk2 T A 11: 113,745,190 (GRCm39) I702F probably damaging Het
Slc16a11 T C 11: 70,106,262 (GRCm39) F119L probably benign Het
Slc2a10 A C 2: 165,359,623 (GRCm39) T496P probably damaging Het
Slc7a2 T C 8: 41,353,206 (GRCm39) Y181H probably damaging Het
Spata31e5 G A 1: 28,817,780 (GRCm39) A84V probably benign Het
Stab2 G T 10: 86,743,054 (GRCm39) P1185Q probably damaging Het
Tcf7l2 T A 19: 55,907,446 (GRCm39) S335R probably damaging Het
Ttc41 G A 10: 86,594,952 (GRCm39) probably null Het
Vmn2r32 A T 7: 7,467,092 (GRCm39) I812N probably damaging Het
Wdr24 C T 17: 26,043,579 (GRCm39) H134Y probably benign Het
Other mutations in Cyp2c67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Cyp2c67 APN 19 39,631,829 (GRCm39) missense possibly damaging 0.95
IGL01025:Cyp2c67 APN 19 39,628,376 (GRCm39) nonsense probably null
IGL01363:Cyp2c67 APN 19 39,628,411 (GRCm39) missense probably damaging 0.99
IGL01819:Cyp2c67 APN 19 39,604,165 (GRCm39) missense probably damaging 0.98
IGL01902:Cyp2c67 APN 19 39,637,470 (GRCm39) missense probably damaging 1.00
IGL02172:Cyp2c67 APN 19 39,637,446 (GRCm39) missense possibly damaging 0.76
IGL02351:Cyp2c67 APN 19 39,605,861 (GRCm39) missense probably damaging 1.00
IGL02355:Cyp2c67 APN 19 39,605,826 (GRCm39) nonsense probably null
IGL02355:Cyp2c67 APN 19 39,631,849 (GRCm39) missense probably benign 0.34
IGL02358:Cyp2c67 APN 19 39,605,861 (GRCm39) missense probably damaging 1.00
IGL02362:Cyp2c67 APN 19 39,605,826 (GRCm39) nonsense probably null
IGL02362:Cyp2c67 APN 19 39,631,849 (GRCm39) missense probably benign 0.34
IGL02388:Cyp2c67 APN 19 39,631,799 (GRCm39) missense probably benign 0.20
IGL03106:Cyp2c67 APN 19 39,632,119 (GRCm39) missense probably benign 0.27
IGL03219:Cyp2c67 APN 19 39,631,738 (GRCm39) missense possibly damaging 0.54
IGL03326:Cyp2c67 APN 19 39,631,713 (GRCm39) critical splice donor site probably null
IGL03349:Cyp2c67 APN 19 39,632,128 (GRCm39) missense probably damaging 1.00
IGL03356:Cyp2c67 APN 19 39,628,405 (GRCm39) missense probably damaging 1.00
IGL03052:Cyp2c67 UTSW 19 39,637,329 (GRCm39) missense possibly damaging 0.88
R0585:Cyp2c67 UTSW 19 39,627,138 (GRCm39) missense possibly damaging 0.59
R0975:Cyp2c67 UTSW 19 39,597,622 (GRCm39) missense possibly damaging 0.49
R0976:Cyp2c67 UTSW 19 39,631,818 (GRCm39) missense probably damaging 1.00
R1252:Cyp2c67 UTSW 19 39,614,585 (GRCm39) missense possibly damaging 0.93
R1398:Cyp2c67 UTSW 19 39,627,069 (GRCm39) missense probably damaging 0.96
R1411:Cyp2c67 UTSW 19 39,627,035 (GRCm39) missense probably damaging 1.00
R1505:Cyp2c67 UTSW 19 39,637,408 (GRCm39) missense probably benign 0.00
R1543:Cyp2c67 UTSW 19 39,631,708 (GRCm39) splice site probably benign
R1613:Cyp2c67 UTSW 19 39,614,643 (GRCm39) missense probably benign 0.00
R1618:Cyp2c67 UTSW 19 39,631,708 (GRCm39) splice site probably benign
R1667:Cyp2c67 UTSW 19 39,632,034 (GRCm39) critical splice donor site probably null
R1852:Cyp2c67 UTSW 19 39,605,811 (GRCm39) missense probably benign 0.01
R2005:Cyp2c67 UTSW 19 39,631,789 (GRCm39) missense probably damaging 1.00
R2105:Cyp2c67 UTSW 19 39,614,681 (GRCm39) missense probably benign 0.24
R2181:Cyp2c67 UTSW 19 39,597,541 (GRCm39) missense possibly damaging 0.94
R3817:Cyp2c67 UTSW 19 39,627,127 (GRCm39) missense probably benign 0.00
R4669:Cyp2c67 UTSW 19 39,632,098 (GRCm39) missense probably benign 0.00
R4689:Cyp2c67 UTSW 19 39,627,032 (GRCm39) missense probably benign 0.00
R4756:Cyp2c67 UTSW 19 39,632,188 (GRCm39) missense probably benign 0.03
R4823:Cyp2c67 UTSW 19 39,604,168 (GRCm39) missense probably benign 0.13
R5152:Cyp2c67 UTSW 19 39,627,132 (GRCm39) missense probably benign 0.00
R5345:Cyp2c67 UTSW 19 39,614,676 (GRCm39) missense probably benign 0.01
R5580:Cyp2c67 UTSW 19 39,604,094 (GRCm39) missense probably damaging 0.99
R5644:Cyp2c67 UTSW 19 39,604,138 (GRCm39) missense possibly damaging 0.84
R6516:Cyp2c67 UTSW 19 39,605,873 (GRCm39) missense probably damaging 1.00
R6550:Cyp2c67 UTSW 19 39,605,854 (GRCm39) nonsense probably null
R6939:Cyp2c67 UTSW 19 39,631,778 (GRCm39) missense possibly damaging 0.68
R6995:Cyp2c67 UTSW 19 39,604,123 (GRCm39) missense probably damaging 0.96
R7028:Cyp2c67 UTSW 19 39,628,341 (GRCm39) missense possibly damaging 0.68
R7144:Cyp2c67 UTSW 19 39,604,138 (GRCm39) missense probably benign 0.00
R7242:Cyp2c67 UTSW 19 39,605,783 (GRCm39) missense probably benign 0.30
R7335:Cyp2c67 UTSW 19 39,628,451 (GRCm39) nonsense probably null
R7337:Cyp2c67 UTSW 19 39,597,708 (GRCm39) splice site probably null
R7474:Cyp2c67 UTSW 19 39,605,876 (GRCm39) missense probably null 0.05
R7642:Cyp2c67 UTSW 19 39,604,084 (GRCm39) missense probably damaging 0.97
R7870:Cyp2c67 UTSW 19 39,597,669 (GRCm39) missense probably damaging 1.00
R8152:Cyp2c67 UTSW 19 39,628,452 (GRCm39) missense probably benign 0.21
R8367:Cyp2c67 UTSW 19 39,627,118 (GRCm39) missense probably benign 0.01
R8717:Cyp2c67 UTSW 19 39,627,155 (GRCm39) missense probably benign 0.05
R8728:Cyp2c67 UTSW 19 39,614,605 (GRCm39) missense probably damaging 1.00
R9275:Cyp2c67 UTSW 19 39,597,699 (GRCm39) missense probably damaging 1.00
R9278:Cyp2c67 UTSW 19 39,597,699 (GRCm39) missense probably damaging 1.00
R9376:Cyp2c67 UTSW 19 39,627,178 (GRCm39) missense probably damaging 1.00
Z1177:Cyp2c67 UTSW 19 39,632,123 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CTGGAATCACACTGAAACAGGG -3'
(R):5'- GGTGATGAACCTGATCACTGATAG -3'

Sequencing Primer
(F):5'- GGAATCACACTGAAACAGGGAACATC -3'
(R):5'- CCTGATCACTGATAGTTAAGATAGGG -3'
Posted On 2017-08-16