Mutagenetix > Incidental Mutations

Incidental Mutation 'R6117:Gapvd1'

List |< first << previous [record 19 of 46] next >> last >|

485147

Institutional Source

Beutler Lab

Gene Symbol

Gapvd1

Ensembl Gene

ENSMUSG00000026867

Gene Name

GTPase activating protein and VPS9 domains 1

Synonyms

4432404J10Rik, 2010005B09Rik

MMRRC Submission

044266-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6117 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34674594-34755232 bp(-) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

T to C at 34690459 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028224] [ENSMUST00000028224] [ENSMUST00000102800] [ENSMUST00000102800] [ENSMUST00000113099] [ENSMUST00000113099]

Predicted Effect

probably null
Transcript: ENSMUST00000028224

SMART Domains

Protein: ENSMUSP00000028224
Gene: ENSMUSG00000026867

Domain	Start	End	E-Value	Type
Pfam:RasGAP	152	353	2.3e-36	PFAM
internal_repeat_1	626	655	3.27e-5	PROSPERO
low complexity region	664	678	N/A	INTRINSIC
internal_repeat_1	686	717	3.27e-5	PROSPERO
low complexity region	875	890	N/A	INTRINSIC
low complexity region	909	920	N/A	INTRINSIC
low complexity region	923	933	N/A	INTRINSIC
low complexity region	936	952	N/A	INTRINSIC
low complexity region	972	982	N/A	INTRINSIC
VPS9	1332	1437	1.08e-24	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000028224

SMART Domains

Protein: ENSMUSP00000028224
Gene: ENSMUSG00000026867

Domain	Start	End	E-Value	Type
Pfam:RasGAP	152	353	2.3e-36	PFAM
internal_repeat_1	626	655	3.27e-5	PROSPERO
low complexity region	664	678	N/A	INTRINSIC
internal_repeat_1	686	717	3.27e-5	PROSPERO
low complexity region	875	890	N/A	INTRINSIC
low complexity region	909	920	N/A	INTRINSIC
low complexity region	923	933	N/A	INTRINSIC
low complexity region	936	952	N/A	INTRINSIC
low complexity region	972	982	N/A	INTRINSIC
VPS9	1332	1437	1.08e-24	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000102800

SMART Domains

Protein: ENSMUSP00000099864
Gene: ENSMUSG00000026867

Domain	Start	End	E-Value	Type
Pfam:RasGAP	152	353	2.3e-36	PFAM
internal_repeat_1	626	655	3.27e-5	PROSPERO
low complexity region	664	678	N/A	INTRINSIC
internal_repeat_1	686	717	3.27e-5	PROSPERO
low complexity region	875	890	N/A	INTRINSIC
low complexity region	909	920	N/A	INTRINSIC
low complexity region	923	933	N/A	INTRINSIC
low complexity region	936	952	N/A	INTRINSIC
low complexity region	972	982	N/A	INTRINSIC
VPS9	1332	1437	1.08e-24	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000102800

SMART Domains

Protein: ENSMUSP00000099864
Gene: ENSMUSG00000026867

Domain	Start	End	E-Value	Type
Pfam:RasGAP	152	353	2.3e-36	PFAM
internal_repeat_1	626	655	3.27e-5	PROSPERO
low complexity region	664	678	N/A	INTRINSIC
internal_repeat_1	686	717	3.27e-5	PROSPERO
low complexity region	875	890	N/A	INTRINSIC
low complexity region	909	920	N/A	INTRINSIC
low complexity region	923	933	N/A	INTRINSIC
low complexity region	936	952	N/A	INTRINSIC
low complexity region	972	982	N/A	INTRINSIC
VPS9	1332	1437	1.08e-24	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113099

SMART Domains

Protein: ENSMUSP00000108723
Gene: ENSMUSG00000026867

Domain	Start	End	E-Value	Type
Pfam:RasGAP	152	353	2.8e-37	PFAM
internal_repeat_1	647	676	3.6e-5	PROSPERO
low complexity region	685	699	N/A	INTRINSIC
internal_repeat_1	707	738	3.6e-5	PROSPERO
low complexity region	896	911	N/A	INTRINSIC
low complexity region	930	941	N/A	INTRINSIC
low complexity region	944	954	N/A	INTRINSIC
low complexity region	957	973	N/A	INTRINSIC
low complexity region	993	1003	N/A	INTRINSIC
VPS9	1353	1458	1.08e-24	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113099

SMART Domains

Protein: ENSMUSP00000108723
Gene: ENSMUSG00000026867

Domain	Start	End	E-Value	Type
Pfam:RasGAP	152	353	2.8e-37	PFAM
internal_repeat_1	647	676	3.6e-5	PROSPERO
low complexity region	685	699	N/A	INTRINSIC
internal_repeat_1	707	738	3.6e-5	PROSPERO
low complexity region	896	911	N/A	INTRINSIC
low complexity region	930	941	N/A	INTRINSIC
low complexity region	944	954	N/A	INTRINSIC
low complexity region	957	973	N/A	INTRINSIC
low complexity region	993	1003	N/A	INTRINSIC
VPS9	1353	1458	1.08e-24	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113101

SMART Domains

Protein: ENSMUSP00000108725
Gene: ENSMUSG00000026867

Domain	Start	End	E-Value	Type
low complexity region	13	28	N/A	INTRINSIC
low complexity region	47	58	N/A	INTRINSIC
low complexity region	61	71	N/A	INTRINSIC
low complexity region	74	90	N/A	INTRINSIC
VPS9	443	548	1.08e-24	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113101

SMART Domains

Protein: ENSMUSP00000108725
Gene: ENSMUSG00000026867

Domain	Start	End	E-Value	Type
low complexity region	13	28	N/A	INTRINSIC
low complexity region	47	58	N/A	INTRINSIC
low complexity region	61	71	N/A	INTRINSIC
low complexity region	74	90	N/A	INTRINSIC
VPS9	443	548	1.08e-24	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113111

SMART Domains

Protein: ENSMUSP00000108735
Gene: ENSMUSG00000026867

Domain	Start	End	E-Value	Type
internal_repeat_1	85	114	3.65e-6	PROSPERO
low complexity region	123	137	N/A	INTRINSIC
internal_repeat_1	145	176	3.65e-6	PROSPERO
low complexity region	334	349	N/A	INTRINSIC
low complexity region	368	379	N/A	INTRINSIC
low complexity region	382	392	N/A	INTRINSIC
low complexity region	395	411	N/A	INTRINSIC
low complexity region	431	441	N/A	INTRINSIC
VPS9	791	896	1.08e-24	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113111

SMART Domains

Protein: ENSMUSP00000108735
Gene: ENSMUSG00000026867

Domain	Start	End	E-Value	Type
internal_repeat_1	85	114	3.65e-6	PROSPERO
low complexity region	123	137	N/A	INTRINSIC
internal_repeat_1	145	176	3.65e-6	PROSPERO
low complexity region	334	349	N/A	INTRINSIC
low complexity region	368	379	N/A	INTRINSIC
low complexity region	382	392	N/A	INTRINSIC
low complexity region	395	411	N/A	INTRINSIC
low complexity region	431	441	N/A	INTRINSIC
VPS9	791	896	1.08e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167251

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agbl1	A	G	7: 76,698,786	Y625C	probably damaging	Het
Ankmy1	A	G	1: 92,861,274		probably benign	Het
Apmap	T	C	2: 150,600,332	T41A	probably benign	Het
Cacna1a	A	G	8: 84,614,721	Y1804C	probably damaging	Het
Cacna1e	A	T	1: 154,561,791	I333N	possibly damaging	Het
Cdsn	C	A	17: 35,555,034	S153R	unknown	Het
Celsr1	A	T	15: 85,932,411	M1777K	probably benign	Het
Cmtr1	A	G	17: 29,682,165	M249V	probably benign	Het
Cmya5	A	G	13: 93,095,166	L1138P	probably damaging	Het
Crim1	A	C	17: 78,303,088	D324A	probably damaging	Het
Dmap1	T	A	4: 117,675,535		probably null	Het
Dnah17	T	C	11: 118,119,571	Y307C	probably benign	Het
Dnah5	T	A	15: 28,270,420	L956H	probably damaging	Het
Enpp3	C	T	10: 24,787,852	S537N	probably damaging	Het
Eya3	T	A	4: 132,711,862	L323Q	probably damaging	Het
Fads3	A	T	19: 10,054,267	H226L	probably damaging	Het
Flrt3	T	A	2: 140,660,445	D421V	possibly damaging	Het
Frmd4a	T	C	2: 4,602,249	V370A	possibly damaging	Het
Gm2178	T	C	14: 26,514,840		probably benign	Het
Gm5592	A	G	7: 41,288,464	N390S	probably benign	Het
Hoxa10	T	A	6: 52,234,820	R39*	probably null	Het
Kcnj1	A	G	9: 32,397,182	T281A	probably damaging	Het
Myo10	T	C	15: 25,805,659	Y1709H	probably benign	Het
Nacad	T	C	11: 6,599,810	D1127G	probably benign	Het
Naip1	T	A	13: 100,444,737	M1L	probably damaging	Het
Olfr1331	A	T	4: 118,869,144	Y121F	probably benign	Het
Olfr811	G	A	10: 129,801,820	A235V	probably damaging	Het
Olfr811	C	A	10: 129,801,821	A235S	probably damaging	Het
Pcdhb12	G	A	18: 37,435,642		probably benign	Het
Pde1b	T	C	15: 103,521,482	V134A	probably damaging	Het
Plxnb2	A	T	15: 89,158,000	D1600E	probably benign	Het
Prss54	T	A	8: 95,565,458		probably null	Het
Ryr3	A	T	2: 112,635,396	I4757N	probably damaging	Het
Slc1a6	T	C	10: 78,788,988	Y76H	possibly damaging	Het
Slco3a1	C	T	7: 74,318,506	D489N	probably benign	Het
Sox15	G	T	11: 69,655,890	G173V	possibly damaging	Het
Stard3	T	C	11: 98,372,262	S48P	probably damaging	Het
Stk32c	G	A	7: 139,122,923	Q67*	probably null	Het
Svil	T	A	18: 5,116,016	W2101R	probably damaging	Het
Taar7e	T	A	10: 24,038,529	Y306N	probably damaging	Het
Tarbp1	T	A	8: 126,427,541	M1485L	probably benign	Het
Togaram1	A	G	12: 64,967,487	D504G	probably damaging	Het
Trrap	T	C	5: 144,802,961	L1091S	possibly damaging	Het
Unc80	A	G	1: 66,675,067	E2856G	possibly damaging	Het
Usp47	C	T	7: 112,087,932	T699M	probably damaging	Het

Other mutations in Gapvd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00799:Gapvd1	APN	2	34699860	missense	probably benign	0.00
IGL00985:Gapvd1	APN	2	34695563	missense	probably damaging	0.99
IGL01133:Gapvd1	APN	2	34725398	missense	probably damaging	0.98
IGL01347:Gapvd1	APN	2	34706696	critical splice donor site	probably null
IGL01830:Gapvd1	APN	2	34688956	missense	probably benign	0.44
IGL01865:Gapvd1	APN	2	34695503	missense	probably null
IGL02009:Gapvd1	APN	2	34704191	missense	probably damaging	1.00
IGL02014:Gapvd1	APN	2	34704191	missense	probably damaging	1.00
IGL02189:Gapvd1	APN	2	34728544	missense	probably damaging	1.00
IGL02418:Gapvd1	APN	2	34730518	missense	probably benign	0.00
IGL02632:Gapvd1	APN	2	34684174	splice site	probably benign
IGL02636:Gapvd1	APN	2	34725404	missense	probably benign	0.01
IGL02643:Gapvd1	APN	2	34704180	missense	probably damaging	1.00
IGL03271:Gapvd1	APN	2	34727207	unclassified	probably benign
P0023:Gapvd1	UTSW	2	34706688	splice site	probably benign
R0016:Gapvd1	UTSW	2	34699913	splice site	probably benign
R0016:Gapvd1	UTSW	2	34699913	splice site	probably benign
R0029:Gapvd1	UTSW	2	34678141	missense	probably damaging	1.00
R0029:Gapvd1	UTSW	2	34678141	missense	probably damaging	1.00
R0282:Gapvd1	UTSW	2	34688960	nonsense	probably null
R0414:Gapvd1	UTSW	2	34693427	missense	probably benign	0.14
R0443:Gapvd1	UTSW	2	34704621	intron	probably benign
R0542:Gapvd1	UTSW	2	34725036	unclassified	probably benign
R0570:Gapvd1	UTSW	2	34728540	missense	probably damaging	1.00
R0840:Gapvd1	UTSW	2	34729113	missense	probably benign	0.29
R0866:Gapvd1	UTSW	2	34709217	missense	probably damaging	1.00
R0890:Gapvd1	UTSW	2	34712317	missense	probably damaging	1.00
R0926:Gapvd1	UTSW	2	34712325	missense	probably damaging	1.00
R0970:Gapvd1	UTSW	2	34730613	splice site	probably null
R1168:Gapvd1	UTSW	2	34704469	missense	probably damaging	1.00
R1391:Gapvd1	UTSW	2	34706802	missense	probably damaging	1.00
R1577:Gapvd1	UTSW	2	34709228	missense	probably damaging	1.00
R1585:Gapvd1	UTSW	2	34712195	missense	possibly damaging	0.93
R1669:Gapvd1	UTSW	2	34730682	critical splice acceptor site	probably null
R1677:Gapvd1	UTSW	2	34700761	critical splice donor site	probably null
R1812:Gapvd1	UTSW	2	34725064	nonsense	probably null
R1874:Gapvd1	UTSW	2	34706021	missense	probably damaging	1.00
R1878:Gapvd1	UTSW	2	34725200	missense	probably benign	0.00
R1974:Gapvd1	UTSW	2	34700841	missense	probably damaging	0.99
R2111:Gapvd1	UTSW	2	34684317	missense	probably benign	0.08
R2921:Gapvd1	UTSW	2	34688863	missense	probably damaging	0.97
R2923:Gapvd1	UTSW	2	34688863	missense	probably damaging	0.97
R3846:Gapvd1	UTSW	2	34729072	nonsense	probably null
R3894:Gapvd1	UTSW	2	34728476	missense	probably benign	0.23
R4405:Gapvd1	UTSW	2	34728735	missense	probably damaging	1.00
R4605:Gapvd1	UTSW	2	34728537	missense	probably damaging	1.00
R4770:Gapvd1	UTSW	2	34691181	missense	probably damaging	0.98
R4935:Gapvd1	UTSW	2	34704492	nonsense	probably null
R5218:Gapvd1	UTSW	2	34728476	missense	probably benign	0.23
R5490:Gapvd1	UTSW	2	34693433	missense	probably benign	0.23
R5571:Gapvd1	UTSW	2	34715253	missense	probably damaging	1.00
R5588:Gapvd1	UTSW	2	34709154	missense	probably damaging	1.00
R5933:Gapvd1	UTSW	2	34684291	missense	probably benign	0.27
R6661:Gapvd1	UTSW	2	34728438	missense	probably damaging	1.00
R6857:Gapvd1	UTSW	2	34728377	missense	probably damaging	1.00
R6950:Gapvd1	UTSW	2	34684245	missense	probably benign	0.04
R7009:Gapvd1	UTSW	2	34700817	missense	probably damaging	1.00
R7125:Gapvd1	UTSW	2	34695600	missense	probably benign
R7154:Gapvd1	UTSW	2	34725063	missense	probably damaging	1.00
R7316:Gapvd1	UTSW	2	34704669	missense	probably damaging	1.00
R7358:Gapvd1	UTSW	2	34690461	critical splice donor site	probably null
R7363:Gapvd1	UTSW	2	34712195	missense	probably benign	0.01
R7371:Gapvd1	UTSW	2	34717373	missense	probably benign
R7418:Gapvd1	UTSW	2	34725118	missense	probably benign	0.12
R7690:Gapvd1	UTSW	2	34729122	missense	possibly damaging	0.68
R7740:Gapvd1	UTSW	2	34700822	missense	probably damaging	1.00
R7742:Gapvd1	UTSW	2	34678623	missense	probably damaging	1.00
R7857:Gapvd1	UTSW	2	34729067	missense	probably benign	0.06
R8062:Gapvd1	UTSW	2	34678114	missense	probably benign	0.37
R8113:Gapvd1	UTSW	2	34704318	missense	probably damaging	0.98
R8303:Gapvd1	UTSW	2	34712200	missense	probably damaging	1.00
Z1177:Gapvd1	UTSW	2	34699864	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- CACTTCTTAACTAACAAGAACTGTCAG -3'
(R):5'- CCCAATTACGGAGAGGTTATGAATCC -3'

Sequencing Primer
(F):5'- CACCACCATGTGCTTTATA -3'
(R):5'- TACGGAGAGGTTATGAATCCTAACAG -3'

Posted On

2017-08-16