Incidental Mutation 'R6117:Dmap1'
ID485151
Institutional Source Beutler Lab
Gene Symbol Dmap1
Ensembl Gene ENSMUSG00000009640
Gene NameDNA methyltransferase 1-associated protein 1
Synonyms1500016M21Rik
MMRRC Submission 044266-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6117 (G1)
Quality Score178.009
Status Not validated
Chromosome4
Chromosomal Location117674681-117682273 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 117675535 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037127] [ENSMUST00000102687]
Predicted Effect probably benign
Transcript: ENSMUST00000037127
SMART Domains Protein: ENSMUSP00000042796
Gene: ENSMUSG00000033423

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
EXOIII 145 329 1.17e-42 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102687
SMART Domains Protein: ENSMUSP00000099748
Gene: ENSMUSG00000009640

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
SANT 148 201 3.38e-2 SMART
Pfam:DMAP1 243 404 7.1e-76 PFAM
low complexity region 449 467 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146384
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of several, distinct complexes involved in the repression or activation of transcription. The encoded protein can independently repress transcription and is targeted to replication foci throughout S phase by interacting directly with the N-terminus of DNA methyltransferase 1. During late S phase, histone deacetylase 2 is added to this complex, providing a means to deacetylate histones in transcriptionally inactive heterochromatin following replication. The encoded protein is also a component of the nucleosome acetyltransferase of H4 complex and interacts with the transcriptional corepressor tumor susceptibility gene 101 and the pro-apoptotic death-associated protein 6, among others. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die prior to implantation with no 8-cell embryos detected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A G 7: 76,698,786 Y625C probably damaging Het
Ankmy1 A G 1: 92,861,274 probably benign Het
Apmap T C 2: 150,600,332 T41A probably benign Het
Cacna1a A G 8: 84,614,721 Y1804C probably damaging Het
Cacna1e A T 1: 154,561,791 I333N possibly damaging Het
Cdsn C A 17: 35,555,034 S153R unknown Het
Celsr1 A T 15: 85,932,411 M1777K probably benign Het
Cmtr1 A G 17: 29,682,165 M249V probably benign Het
Cmya5 A G 13: 93,095,166 L1138P probably damaging Het
Crim1 A C 17: 78,303,088 D324A probably damaging Het
Dnah17 T C 11: 118,119,571 Y307C probably benign Het
Dnah5 T A 15: 28,270,420 L956H probably damaging Het
Enpp3 C T 10: 24,787,852 S537N probably damaging Het
Eya3 T A 4: 132,711,862 L323Q probably damaging Het
Fads3 A T 19: 10,054,267 H226L probably damaging Het
Flrt3 T A 2: 140,660,445 D421V possibly damaging Het
Frmd4a T C 2: 4,602,249 V370A possibly damaging Het
Gapvd1 T C 2: 34,690,459 probably null Het
Gm2178 T C 14: 26,514,840 probably benign Het
Gm5592 A G 7: 41,288,464 N390S probably benign Het
Hoxa10 T A 6: 52,234,820 R39* probably null Het
Kcnj1 A G 9: 32,397,182 T281A probably damaging Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Naip1 T A 13: 100,444,737 M1L probably damaging Het
Olfr1331 A T 4: 118,869,144 Y121F probably benign Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Pcdhb12 G A 18: 37,435,642 probably benign Het
Pde1b T C 15: 103,521,482 V134A probably damaging Het
Plxnb2 A T 15: 89,158,000 D1600E probably benign Het
Prss54 T A 8: 95,565,458 probably null Het
Ryr3 A T 2: 112,635,396 I4757N probably damaging Het
Slc1a6 T C 10: 78,788,988 Y76H possibly damaging Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Sox15 G T 11: 69,655,890 G173V possibly damaging Het
Stard3 T C 11: 98,372,262 S48P probably damaging Het
Stk32c G A 7: 139,122,923 Q67* probably null Het
Svil T A 18: 5,116,016 W2101R probably damaging Het
Taar7e T A 10: 24,038,529 Y306N probably damaging Het
Tarbp1 T A 8: 126,427,541 M1485L probably benign Het
Togaram1 A G 12: 64,967,487 D504G probably damaging Het
Trrap T C 5: 144,802,961 L1091S possibly damaging Het
Unc80 A G 1: 66,675,067 E2856G possibly damaging Het
Usp47 C T 7: 112,087,932 T699M probably damaging Het
Other mutations in Dmap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Dmap1 APN 4 117676396 missense possibly damaging 0.67
IGL01517:Dmap1 APN 4 117676009 missense probably damaging 1.00
IGL02926:Dmap1 APN 4 117681888 missense probably benign 0.01
R0118:Dmap1 UTSW 4 117676483 missense probably damaging 1.00
R1586:Dmap1 UTSW 4 117676122 missense probably damaging 0.98
R2504:Dmap1 UTSW 4 117675298 missense probably damaging 1.00
R2940:Dmap1 UTSW 4 117676005 missense possibly damaging 0.72
R4168:Dmap1 UTSW 4 117681310 missense possibly damaging 0.91
R4723:Dmap1 UTSW 4 117676039 missense probably benign 0.05
R4975:Dmap1 UTSW 4 117681036 missense possibly damaging 0.91
R5797:Dmap1 UTSW 4 117675480 missense possibly damaging 0.94
R5905:Dmap1 UTSW 4 117676766 missense probably benign 0.00
R5987:Dmap1 UTSW 4 117680842 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTGCAAGCAAGACAAAGCTG -3'
(R):5'- ATGCAGTATTGGGCCCTTGG -3'

Sequencing Primer
(F):5'- AAGCTGGACTATGGTCACATGCC -3'
(R):5'- TGGCTCCAGGTGGCCTAATG -3'
Posted On2017-08-16