Mutagenetix > Incidental Mutations

Incidental Mutation 'R6117:Dmap1'

List |< first << previous [record 11 of 46] next >> last >|

485151

Institutional Source

Beutler Lab

Gene Symbol

Dmap1

Ensembl Gene

ENSMUSG00000009640

Gene Name

DNA methyltransferase 1-associated protein 1

Synonyms

1500016M21Rik

MMRRC Submission

044266-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6117 (G1)

Quality Score

178.009

Status

Not validated

Chromosome

Chromosomal Location

117674681-117682273 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 117675535 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000099748 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037127] [ENSMUST00000102687]

Predicted Effect

probably benign
Transcript: ENSMUST00000037127

SMART Domains

Protein: ENSMUSP00000042796
Gene: ENSMUSG00000033423

Domain	Start	End	E-Value	Type
low complexity region	23	35	N/A	INTRINSIC
low complexity region	124	135	N/A	INTRINSIC
EXOIII	145	329	1.17e-42	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000102687

SMART Domains

Protein: ENSMUSP00000099748
Gene: ENSMUSG00000009640

Domain	Start	End	E-Value	Type
low complexity region	25	42	N/A	INTRINSIC
SANT	148	201	3.38e-2	SMART
Pfam:DMAP1	243	404	7.1e-76	PFAM
low complexity region	449	467	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129510

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134379

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135582

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146384

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of several, distinct complexes involved in the repression or activation of transcription. The encoded protein can independently repress transcription and is targeted to replication foci throughout S phase by interacting directly with the N-terminus of DNA methyltransferase 1. During late S phase, histone deacetylase 2 is added to this complex, providing a means to deacetylate histones in transcriptionally inactive heterochromatin following replication. The encoded protein is also a component of the nucleosome acetyltransferase of H4 complex and interacts with the transcriptional corepressor tumor susceptibility gene 101 and the pro-apoptotic death-associated protein 6, among others. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die prior to implantation with no 8-cell embryos detected. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agbl1	A	G	7: 76,698,786	Y625C	probably damaging	Het
Ankmy1	A	G	1: 92,861,274		probably benign	Het
Apmap	T	C	2: 150,600,332	T41A	probably benign	Het
Cacna1a	A	G	8: 84,614,721	Y1804C	probably damaging	Het
Cacna1e	A	T	1: 154,561,791	I333N	possibly damaging	Het
Cdsn	C	A	17: 35,555,034	S153R	unknown	Het
Celsr1	A	T	15: 85,932,411	M1777K	probably benign	Het
Cmtr1	A	G	17: 29,682,165	M249V	probably benign	Het
Cmya5	A	G	13: 93,095,166	L1138P	probably damaging	Het
Crim1	A	C	17: 78,303,088	D324A	probably damaging	Het
Dnah17	T	C	11: 118,119,571	Y307C	probably benign	Het
Dnah5	T	A	15: 28,270,420	L956H	probably damaging	Het
Enpp3	C	T	10: 24,787,852	S537N	probably damaging	Het
Eya3	T	A	4: 132,711,862	L323Q	probably damaging	Het
Fads3	A	T	19: 10,054,267	H226L	probably damaging	Het
Flrt3	T	A	2: 140,660,445	D421V	possibly damaging	Het
Frmd4a	T	C	2: 4,602,249	V370A	possibly damaging	Het
Gapvd1	T	C	2: 34,690,459		probably null	Het
Gm2178	T	C	14: 26,514,840		probably benign	Het
Gm5592	A	G	7: 41,288,464	N390S	probably benign	Het
Hoxa10	T	A	6: 52,234,820	R39*	probably null	Het
Kcnj1	A	G	9: 32,397,182	T281A	probably damaging	Het
Myo10	T	C	15: 25,805,659	Y1709H	probably benign	Het
Nacad	T	C	11: 6,599,810	D1127G	probably benign	Het
Naip1	T	A	13: 100,444,737	M1L	probably damaging	Het
Olfr1331	A	T	4: 118,869,144	Y121F	probably benign	Het
Olfr811	G	A	10: 129,801,820	A235V	probably damaging	Het
Olfr811	C	A	10: 129,801,821	A235S	probably damaging	Het
Pcdhb12	G	A	18: 37,435,642		probably benign	Het
Pde1b	T	C	15: 103,521,482	V134A	probably damaging	Het
Plxnb2	A	T	15: 89,158,000	D1600E	probably benign	Het
Prss54	T	A	8: 95,565,458		probably null	Het
Ryr3	A	T	2: 112,635,396	I4757N	probably damaging	Het
Slc1a6	T	C	10: 78,788,988	Y76H	possibly damaging	Het
Slco3a1	C	T	7: 74,318,506	D489N	probably benign	Het
Sox15	G	T	11: 69,655,890	G173V	possibly damaging	Het
Stard3	T	C	11: 98,372,262	S48P	probably damaging	Het
Stk32c	G	A	7: 139,122,923	Q67*	probably null	Het
Svil	T	A	18: 5,116,016	W2101R	probably damaging	Het
Taar7e	T	A	10: 24,038,529	Y306N	probably damaging	Het
Tarbp1	T	A	8: 126,427,541	M1485L	probably benign	Het
Togaram1	A	G	12: 64,967,487	D504G	probably damaging	Het
Trrap	T	C	5: 144,802,961	L1091S	possibly damaging	Het
Unc80	A	G	1: 66,675,067	E2856G	possibly damaging	Het
Usp47	C	T	7: 112,087,932	T699M	probably damaging	Het

Other mutations in Dmap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00786:Dmap1	APN	4	117676396	missense	possibly damaging	0.67
IGL01517:Dmap1	APN	4	117676009	missense	probably damaging	1.00
IGL02926:Dmap1	APN	4	117681888	missense	probably benign	0.01
R0118:Dmap1	UTSW	4	117676483	missense	probably damaging	1.00
R1586:Dmap1	UTSW	4	117676122	missense	probably damaging	0.98
R2504:Dmap1	UTSW	4	117675298	missense	probably damaging	1.00
R2940:Dmap1	UTSW	4	117676005	missense	possibly damaging	0.72
R4168:Dmap1	UTSW	4	117681310	missense	possibly damaging	0.91
R4723:Dmap1	UTSW	4	117676039	missense	probably benign	0.05
R4975:Dmap1	UTSW	4	117681036	missense	possibly damaging	0.91
R5797:Dmap1	UTSW	4	117675480	missense	possibly damaging	0.94
R5905:Dmap1	UTSW	4	117676766	missense	probably benign	0.00
R5987:Dmap1	UTSW	4	117680842	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCTGCAAGCAAGACAAAGCTG -3'
(R):5'- ATGCAGTATTGGGCCCTTGG -3'

Sequencing Primer
(F):5'- AAGCTGGACTATGGTCACATGCC -3'
(R):5'- TGGCTCCAGGTGGCCTAATG -3'

Posted On

2017-08-16