Incidental Mutation 'R6117:Eya3'
ID485153
Institutional Source Beutler Lab
Gene Symbol Eya3
Ensembl Gene ENSMUSG00000028886
Gene NameEYA transcriptional coactivator and phosphatase 3
Synonyms
MMRRC Submission 044266-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.675) question?
Stock #R6117 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location132638987-132724765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 132711862 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 323 (L323Q)
Ref Sequence ENSEMBL: ENSMUSP00000136812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020197] [ENSMUST00000079157] [ENSMUST00000081726] [ENSMUST00000180250]
Predicted Effect probably damaging
Transcript: ENSMUST00000020197
AA Change: L323Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020197
Gene: ENSMUSG00000028886
AA Change: L323Q

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
PDB:4EGC|B 132 416 1e-136 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000079157
AA Change: L417Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078157
Gene: ENSMUSG00000028886
AA Change: L417Q

DomainStartEndE-ValueType
low complexity region 72 89 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
low complexity region 165 177 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
PDB:4EGC|B 226 510 1e-135 PDB
SCOP:d1lvha_ 345 507 8e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081726
AA Change: L433Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080425
Gene: ENSMUSG00000028886
AA Change: L433Q

DomainStartEndE-ValueType
low complexity region 88 105 N/A INTRINSIC
low complexity region 129 148 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 208 219 N/A INTRINSIC
Pfam:Hydrolase 256 502 5.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157029
Predicted Effect probably damaging
Transcript: ENSMUST00000180250
AA Change: L323Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136812
Gene: ENSMUSG00000028886
AA Change: L323Q

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
PDB:4EGC|B 132 416 1e-136 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may act as a transcriptional activator and have a role during development. It can act as a mediator of chemoresistance and cell survival in Ewing sarcoma cells, where this gene is up-regulated via a micro-RNA that binds to the 3' UTR of the transcript. A similar protein in mice acts as a transcriptional activator. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit abnormal heart function, decreased grip strength and increased exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A G 7: 76,698,786 Y625C probably damaging Het
Ankmy1 A G 1: 92,861,274 probably benign Het
Apmap T C 2: 150,600,332 T41A probably benign Het
Cacna1a A G 8: 84,614,721 Y1804C probably damaging Het
Cacna1e A T 1: 154,561,791 I333N possibly damaging Het
Cdsn C A 17: 35,555,034 S153R unknown Het
Celsr1 A T 15: 85,932,411 M1777K probably benign Het
Cmtr1 A G 17: 29,682,165 M249V probably benign Het
Cmya5 A G 13: 93,095,166 L1138P probably damaging Het
Crim1 A C 17: 78,303,088 D324A probably damaging Het
Dmap1 T A 4: 117,675,535 probably null Het
Dnah17 T C 11: 118,119,571 Y307C probably benign Het
Dnah5 T A 15: 28,270,420 L956H probably damaging Het
Enpp3 C T 10: 24,787,852 S537N probably damaging Het
Fads3 A T 19: 10,054,267 H226L probably damaging Het
Flrt3 T A 2: 140,660,445 D421V possibly damaging Het
Frmd4a T C 2: 4,602,249 V370A possibly damaging Het
Gapvd1 T C 2: 34,690,459 probably null Het
Gm2178 T C 14: 26,514,840 probably benign Het
Gm5592 A G 7: 41,288,464 N390S probably benign Het
Hoxa10 T A 6: 52,234,820 R39* probably null Het
Kcnj1 A G 9: 32,397,182 T281A probably damaging Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Naip1 T A 13: 100,444,737 M1L probably damaging Het
Olfr1331 A T 4: 118,869,144 Y121F probably benign Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Pcdhb12 G A 18: 37,435,642 probably benign Het
Pde1b T C 15: 103,521,482 V134A probably damaging Het
Plxnb2 A T 15: 89,158,000 D1600E probably benign Het
Prss54 T A 8: 95,565,458 probably null Het
Ryr3 A T 2: 112,635,396 I4757N probably damaging Het
Slc1a6 T C 10: 78,788,988 Y76H possibly damaging Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Sox15 G T 11: 69,655,890 G173V possibly damaging Het
Stard3 T C 11: 98,372,262 S48P probably damaging Het
Stk32c G A 7: 139,122,923 Q67* probably null Het
Svil T A 18: 5,116,016 W2101R probably damaging Het
Taar7e T A 10: 24,038,529 Y306N probably damaging Het
Tarbp1 T A 8: 126,427,541 M1485L probably benign Het
Togaram1 A G 12: 64,967,487 D504G probably damaging Het
Trrap T C 5: 144,802,961 L1091S possibly damaging Het
Unc80 A G 1: 66,675,067 E2856G possibly damaging Het
Usp47 C T 7: 112,087,932 T699M probably damaging Het
Other mutations in Eya3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Eya3 APN 4 132704398 missense probably damaging 1.00
IGL01104:Eya3 APN 4 132711929 missense probably damaging 1.00
IGL01109:Eya3 APN 4 132693000 nonsense probably null
IGL01145:Eya3 APN 4 132709995 missense probably damaging 1.00
IGL02364:Eya3 APN 4 132710055 missense probably damaging 1.00
IGL03008:Eya3 APN 4 132706983 missense probably damaging 1.00
IGL03144:Eya3 APN 4 132693142 missense probably benign 0.07
IGL03176:Eya3 APN 4 132711922 missense possibly damaging 0.90
R0279:Eya3 UTSW 4 132719247 missense probably damaging 1.00
R0621:Eya3 UTSW 4 132694802 missense probably benign 0.00
R0893:Eya3 UTSW 4 132689786 missense probably benign 0.01
R1416:Eya3 UTSW 4 132707129 splice site probably benign
R1834:Eya3 UTSW 4 132707118 missense probably damaging 0.99
R1903:Eya3 UTSW 4 132721352 splice site probably null
R4696:Eya3 UTSW 4 132670232 nonsense probably null
R4739:Eya3 UTSW 4 132721387 utr 3 prime probably benign
R4758:Eya3 UTSW 4 132694885 critical splice donor site probably null
R5061:Eya3 UTSW 4 132704378 missense probably damaging 1.00
R5411:Eya3 UTSW 4 132689779 missense probably damaging 0.99
R5479:Eya3 UTSW 4 132672933 missense possibly damaging 0.91
R6343:Eya3 UTSW 4 132672910 missense probably damaging 0.96
R6443:Eya3 UTSW 4 132711927 missense probably damaging 1.00
R6460:Eya3 UTSW 4 132680863 missense probably damaging 0.97
R7116:Eya3 UTSW 4 132694799 missense probably benign 0.00
R7418:Eya3 UTSW 4 132680848 missense possibly damaging 0.92
R7594:Eya3 UTSW 4 132694825 missense probably benign
R7624:Eya3 UTSW 4 132672951 missense probably benign 0.41
R7811:Eya3 UTSW 4 132711961 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TGTGTATAAGCCATCTCACTGG -3'
(R):5'- CAGCTTGTGTACCGACAGTAAC -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAATGGGTTCTAG -3'
(R):5'- TTGTGTACCGACAGTAACACAGC -3'
Posted On2017-08-16