Incidental Mutation 'R6117:Gm5592'
List |< first << previous [record 21 of 46] next >> last >|
ID485156
Institutional Source Beutler Lab
Gene Symbol Gm5592
Ensembl Gene ENSMUSG00000072259
Gene Namepredicted gene 5592
Synonyms
MMRRC Submission 044266-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6117 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location41153841-41290183 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41288464 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 390 (N390S)
Ref Sequence ENSEMBL: ENSMUSP00000145899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097044] [ENSMUST00000206490]
Predicted Effect probably benign
Transcript: ENSMUST00000097044
AA Change: N390S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000094809
Gene: ENSMUSG00000072259
AA Change: N390S

DomainStartEndE-ValueType
Pfam:DUF4629 435 580 6.1e-60 PFAM
low complexity region 607 612 N/A INTRINSIC
low complexity region 708 725 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206040
Predicted Effect probably benign
Transcript: ENSMUST00000206490
AA Change: N390S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A G 7: 76,698,786 Y625C probably damaging Het
Ankmy1 A G 1: 92,861,274 probably benign Het
Apmap T C 2: 150,600,332 T41A probably benign Het
Cacna1a A G 8: 84,614,721 Y1804C probably damaging Het
Cacna1e A T 1: 154,561,791 I333N possibly damaging Het
Cdsn C A 17: 35,555,034 S153R unknown Het
Celsr1 A T 15: 85,932,411 M1777K probably benign Het
Cmtr1 A G 17: 29,682,165 M249V probably benign Het
Cmya5 A G 13: 93,095,166 L1138P probably damaging Het
Crim1 A C 17: 78,303,088 D324A probably damaging Het
Dmap1 T A 4: 117,675,535 probably null Het
Dnah17 T C 11: 118,119,571 Y307C probably benign Het
Dnah5 T A 15: 28,270,420 L956H probably damaging Het
Enpp3 C T 10: 24,787,852 S537N probably damaging Het
Eya3 T A 4: 132,711,862 L323Q probably damaging Het
Fads3 A T 19: 10,054,267 H226L probably damaging Het
Flrt3 T A 2: 140,660,445 D421V possibly damaging Het
Frmd4a T C 2: 4,602,249 V370A possibly damaging Het
Gapvd1 T C 2: 34,690,459 probably null Het
Gm2178 T C 14: 26,514,840 probably benign Het
Hoxa10 T A 6: 52,234,820 R39* probably null Het
Kcnj1 A G 9: 32,397,182 T281A probably damaging Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Naip1 T A 13: 100,444,737 M1L probably damaging Het
Olfr1331 A T 4: 118,869,144 Y121F probably benign Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Pcdhb12 G A 18: 37,435,642 probably benign Het
Pde1b T C 15: 103,521,482 V134A probably damaging Het
Plxnb2 A T 15: 89,158,000 D1600E probably benign Het
Prss54 T A 8: 95,565,458 probably null Het
Ryr3 A T 2: 112,635,396 I4757N probably damaging Het
Slc1a6 T C 10: 78,788,988 Y76H possibly damaging Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Sox15 G T 11: 69,655,890 G173V possibly damaging Het
Stard3 T C 11: 98,372,262 S48P probably damaging Het
Stk32c G A 7: 139,122,923 Q67* probably null Het
Svil T A 18: 5,116,016 W2101R probably damaging Het
Taar7e T A 10: 24,038,529 Y306N probably damaging Het
Tarbp1 T A 8: 126,427,541 M1485L probably benign Het
Togaram1 A G 12: 64,967,487 D504G probably damaging Het
Trrap T C 5: 144,802,961 L1091S possibly damaging Het
Unc80 A G 1: 66,675,067 E2856G possibly damaging Het
Usp47 C T 7: 112,087,932 T699M probably damaging Het
Other mutations in Gm5592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Gm5592 APN 7 41289095 missense probably damaging 1.00
IGL01472:Gm5592 APN 7 41286074 splice site probably benign
IGL01718:Gm5592 APN 7 41289193 missense probably damaging 0.99
IGL01981:Gm5592 APN 7 41286371 nonsense probably null
IGL02318:Gm5592 APN 7 41286788 missense probably benign 0.37
IGL02346:Gm5592 APN 7 41289465 missense probably damaging 0.97
IGL02904:Gm5592 APN 7 41288386 missense probably damaging 1.00
I1329:Gm5592 UTSW 7 41286354 nonsense probably null
R0465:Gm5592 UTSW 7 41156057 intron probably benign
R0669:Gm5592 UTSW 7 41155830 intron probably benign
R0675:Gm5592 UTSW 7 41289387 missense possibly damaging 0.81
R1381:Gm5592 UTSW 7 41286172 missense probably benign
R1731:Gm5592 UTSW 7 41288413 missense probably damaging 0.99
R3149:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3150:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3176:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3177:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3276:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3277:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3623:Gm5592 UTSW 7 41157628 intron probably benign
R3797:Gm5592 UTSW 7 41157835 intron probably benign
R3854:Gm5592 UTSW 7 41157835 intron probably benign
R3856:Gm5592 UTSW 7 41157835 intron probably benign
R4009:Gm5592 UTSW 7 41289510 missense probably benign 0.01
R4010:Gm5592 UTSW 7 41286628 missense probably benign 0.05
R4011:Gm5592 UTSW 7 41289510 missense probably benign 0.01
R4127:Gm5592 UTSW 7 41289067 missense probably benign 0.00
R4162:Gm5592 UTSW 7 41217778 intron probably benign
R4289:Gm5592 UTSW 7 41158912 intron probably benign
R4304:Gm5592 UTSW 7 41286262 missense probably benign 0.20
R4332:Gm5592 UTSW 7 41216118 intron probably benign
R4408:Gm5592 UTSW 7 41286448 missense probably benign 0.04
R4572:Gm5592 UTSW 7 41216159 intron probably benign
R4764:Gm5592 UTSW 7 41216118 intron probably benign
R4822:Gm5592 UTSW 7 41155890 intron probably benign
R4836:Gm5592 UTSW 7 41215534 intron probably benign
R4854:Gm5592 UTSW 7 41217471 intron probably benign
R5032:Gm5592 UTSW 7 41289735 missense probably damaging 1.00
R5075:Gm5592 UTSW 7 41158963 intron probably benign
R5369:Gm5592 UTSW 7 41218211 intron probably benign
R5424:Gm5592 UTSW 7 41155593 intron probably benign
R5700:Gm5592 UTSW 7 41158579 intron probably benign
R5741:Gm5592 UTSW 7 41289201 missense probably benign
R5802:Gm5592 UTSW 7 41219105 intron probably benign
R5945:Gm5592 UTSW 7 41215612 intron probably benign
R6324:Gm5592 UTSW 7 41286535 missense probably damaging 0.98
R6449:Gm5592 UTSW 7 41288586 missense probably benign 0.09
R6571:Gm5592 UTSW 7 41288575 missense probably damaging 0.98
R6776:Gm5592 UTSW 7 41289729 missense probably damaging 1.00
R7595:Gm5592 UTSW 7 41286443 missense probably damaging 0.99
R7658:Gm5592 UTSW 7 41288710 missense probably benign 0.03
R7699:Gm5592 UTSW 7 41286407 missense probably damaging 1.00
R7700:Gm5592 UTSW 7 41286407 missense probably damaging 1.00
R7774:Gm5592 UTSW 7 41289859 missense probably damaging 1.00
R7788:Gm5592 UTSW 7 41286694 missense probably benign 0.01
R7890:Gm5592 UTSW 7 41286759 missense probably damaging 1.00
R8070:Gm5592 UTSW 7 41286463 missense possibly damaging 0.76
R8417:Gm5592 UTSW 7 41288551 missense probably benign 0.38
X0021:Gm5592 UTSW 7 41288508 missense probably benign 0.01
Z1176:Gm5592 UTSW 7 41286317 missense probably damaging 1.00
Z1176:Gm5592 UTSW 7 41286319 missense possibly damaging 0.94
Z1176:Gm5592 UTSW 7 41288681 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCAGAGTTCCTGGCCTTGC -3'
(R):5'- TGGAATTTGGCCTGAGGAGC -3'

Sequencing Primer
(F):5'- TCCAGCTCCAAGCCTGG -3'
(R):5'- CCTCAAGCAACTCAAAGGATTTATG -3'
Posted On2017-08-16