Mutagenetix > Incidental Mutations

Incidental Mutation 'R6117:Agbl1'

List [record 1 of 46] next >> last >|

485158

Institutional Source

Beutler Lab

Gene Symbol

Agbl1

Ensembl Gene

ENSMUSG00000025754

Gene Name

ATP/GTP binding protein-like 1

Synonyms

Nna1-l1, EG244071

MMRRC Submission

044266-MU

Accession Numbers

Ncbi RefSeq: NM_001199224.1; MGI:3646469

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6117 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

76229887-77124698 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76698786 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 625 (Y625C)

Ref Sequence

ENSEMBL: ENSMUSP00000103066 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026854] [ENSMUST00000107442] [ENSMUST00000156166]

Predicted Effect

probably damaging
Transcript: ENSMUST00000026854
AA Change: Y625C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000026854
Gene: ENSMUSG00000025754
AA Change: Y625C

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Pfam:Peptidase_M14	493	631	4.4e-22	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000107442
AA Change: Y625C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103066
Gene: ENSMUSG00000025754
AA Change: Y625C

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Pfam:Peptidase_M14	494	754	3.1e-27	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000156166
AA Change: Y877C

SMART Domains

Protein: ENSMUSP00000119721
Gene: ENSMUSG00000025754
AA Change: Y877C

Domain	Start	End	E-Value	Type
low complexity region	254	270	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206401

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyglutamylation is a reversible posttranslational modification catalyzed by polyglutamylases that results in the addition of glutamate side chains on the modified protein. This gene encodes a glutamate decarboxylase that catalyzes the deglutamylation of polyglutamylated proteins. Mutations in this gene result in dominant late-onset Fuchs corneal dystrophy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankmy1	A	G	1: 92,861,274		probably benign	Het
Apmap	T	C	2: 150,600,332	T41A	probably benign	Het
Cacna1a	A	G	8: 84,614,721	Y1804C	probably damaging	Het
Cacna1e	A	T	1: 154,561,791	I333N	possibly damaging	Het
Cdsn	C	A	17: 35,555,034	S153R	unknown	Het
Celsr1	A	T	15: 85,932,411	M1777K	probably benign	Het
Cmtr1	A	G	17: 29,682,165	M249V	probably benign	Het
Cmya5	A	G	13: 93,095,166	L1138P	probably damaging	Het
Crim1	A	C	17: 78,303,088	D324A	probably damaging	Het
Dmap1	T	A	4: 117,675,535		probably null	Het
Dnah17	T	C	11: 118,119,571	Y307C	probably benign	Het
Dnah5	T	A	15: 28,270,420	L956H	probably damaging	Het
Enpp3	C	T	10: 24,787,852	S537N	probably damaging	Het
Eya3	T	A	4: 132,711,862	L323Q	probably damaging	Het
Fads3	A	T	19: 10,054,267	H226L	probably damaging	Het
Flrt3	T	A	2: 140,660,445	D421V	possibly damaging	Het
Frmd4a	T	C	2: 4,602,249	V370A	possibly damaging	Het
Gapvd1	T	C	2: 34,690,459		probably null	Het
Gm2178	T	C	14: 26,514,840		probably benign	Het
Gm5592	A	G	7: 41,288,464	N390S	probably benign	Het
Hoxa10	T	A	6: 52,234,820	R39*	probably null	Het
Kcnj1	A	G	9: 32,397,182	T281A	probably damaging	Het
Myo10	T	C	15: 25,805,659	Y1709H	probably benign	Het
Nacad	T	C	11: 6,599,810	D1127G	probably benign	Het
Naip1	T	A	13: 100,444,737	M1L	probably damaging	Het
Olfr1331	A	T	4: 118,869,144	Y121F	probably benign	Het
Olfr811	G	A	10: 129,801,820	A235V	probably damaging	Het
Olfr811	C	A	10: 129,801,821	A235S	probably damaging	Het
Pcdhb12	G	A	18: 37,435,642		probably benign	Het
Pde1b	T	C	15: 103,521,482	V134A	probably damaging	Het
Plxnb2	A	T	15: 89,158,000	D1600E	probably benign	Het
Prss54	T	A	8: 95,565,458		probably null	Het
Ryr3	A	T	2: 112,635,396	I4757N	probably damaging	Het
Slc1a6	T	C	10: 78,788,988	Y76H	possibly damaging	Het
Slco3a1	C	T	7: 74,318,506	D489N	probably benign	Het
Sox15	G	T	11: 69,655,890	G173V	possibly damaging	Het
Stard3	T	C	11: 98,372,262	S48P	probably damaging	Het
Stk32c	G	A	7: 139,122,923	Q67*	probably null	Het
Svil	T	A	18: 5,116,016	W2101R	probably damaging	Het
Taar7e	T	A	10: 24,038,529	Y306N	probably damaging	Het
Tarbp1	T	A	8: 126,427,541	M1485L	probably benign	Het
Togaram1	A	G	12: 64,967,487	D504G	probably damaging	Het
Trrap	T	C	5: 144,802,961	L1091S	possibly damaging	Het
Unc80	A	G	1: 66,675,067	E2856G	possibly damaging	Het
Usp47	C	T	7: 112,087,932	T699M	probably damaging	Het

Other mutations in Agbl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01567:Agbl1	APN	7	76421880	missense	probably benign	0.01
IGL01650:Agbl1	APN	7	76420319	missense	probably damaging	1.00
IGL02244:Agbl1	APN	7	76766372	missense	probably damaging	1.00
IGL03088:Agbl1	APN	7	76720142	missense	probably benign	0.12
IGL03143:Agbl1	APN	7	76420045	nonsense	probably null
IGL03306:Agbl1	APN	7	76589504	missense	probably damaging	1.00
R0001:Agbl1	UTSW	7	76419863	missense	probably damaging	0.98
R0045:Agbl1	UTSW	7	76698840	critical splice donor site	probably null
R0045:Agbl1	UTSW	7	76698840	critical splice donor site	probably null
R0541:Agbl1	UTSW	7	76409245	missense	probably benign	0.22
R1889:Agbl1	UTSW	7	76589381	missense	probably damaging	1.00
R2089:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2091:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2091:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2127:Agbl1	UTSW	7	76419880	missense	possibly damaging	0.64
R2148:Agbl1	UTSW	7	76414717	splice site	probably null
R2229:Agbl1	UTSW	7	76433378	missense	probably benign	0.43
R2243:Agbl1	UTSW	7	76418722	missense	possibly damaging	0.93
R2255:Agbl1	UTSW	7	76422184	missense	probably damaging	1.00
R2411:Agbl1	UTSW	7	76720150	missense	probably damaging	1.00
R2426:Agbl1	UTSW	7	76421902	missense	probably damaging	1.00
R2508:Agbl1	UTSW	7	76589550	critical splice donor site	probably null
R2910:Agbl1	UTSW	7	76419838	missense	probably benign	0.13
R2919:Agbl1	UTSW	7	76414658	missense	probably damaging	1.00
R3056:Agbl1	UTSW	7	76766484	missense	possibly damaging	0.60
R3153:Agbl1	UTSW	7	76720196	missense	probably damaging	1.00
R3770:Agbl1	UTSW	7	76425929	critical splice donor site	probably null
R3825:Agbl1	UTSW	7	76419967	missense	probably damaging	0.99
R4632:Agbl1	UTSW	7	76413685	missense	probably benign	0.00
R4857:Agbl1	UTSW	7	76419835	missense	probably benign	0.03
R4943:Agbl1	UTSW	7	76420016	missense	probably benign	0.01
R5055:Agbl1	UTSW	7	76413577	missense	probably damaging	1.00
R5071:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5072:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5074:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5095:Agbl1	UTSW	7	76720133	missense	probably damaging	0.96
R5133:Agbl1	UTSW	7	76422156	missense	probably benign	0.21
R5576:Agbl1	UTSW	7	76335237	missense	probably benign	0.03
R5665:Agbl1	UTSW	7	76589503	missense	probably damaging	1.00
R5849:Agbl1	UTSW	7	76325098	missense	probably benign	0.35
R5924:Agbl1	UTSW	7	76409234	missense	probably benign	0.12
R6044:Agbl1	UTSW	7	76318120	missense	possibly damaging	0.56
R6144:Agbl1	UTSW	7	76420084	missense	probably benign	0.02
R6368:Agbl1	UTSW	7	76419830	missense	probably benign	0.25
R6806:Agbl1	UTSW	7	76425921	missense	probably damaging	1.00
R7455:Agbl1	UTSW	7	76424755	missense	unknown
R7459:Agbl1	UTSW	7	76420066	missense	not run
R7485:Agbl1	UTSW	7	76589493	missense	unknown
R7516:Agbl1	UTSW	7	76425921	missense	probably damaging	1.00
R7539:Agbl1	UTSW	7	76425929	critical splice donor site	probably null
R7561:Agbl1	UTSW	7	76698761	missense	unknown
R7630:Agbl1	UTSW	7	76886156	missense	unknown
R7655:Agbl1	UTSW	7	76409332	missense
R7656:Agbl1	UTSW	7	76409332	missense
R7658:Agbl1	UTSW	7	76766369	missense	unknown
R7681:Agbl1	UTSW	7	76444901	missense	unknown
R7694:Agbl1	UTSW	7	76698765	missense	unknown
R7773:Agbl1	UTSW	7	76698837	missense	unknown
R7981:Agbl1	UTSW	7	76444840	missense	unknown
R8208:Agbl1	UTSW	7	76720168	missense	unknown
R8317:Agbl1	UTSW	7	76422181	missense	unknown
R8406:Agbl1	UTSW	7	76418667	missense
R8432:Agbl1	UTSW	7	77124686	missense	unknown
Z1088:Agbl1	UTSW	7	76419904	missense	probably benign	0.00
Z1176:Agbl1	UTSW	7	76418685	missense
Z1177:Agbl1	UTSW	7	76720206	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACAGATCTGCAGCTTCCTG -3'
(R):5'- AAAGTTTCCCACATATGTTTGTCCC -3'

Sequencing Primer
(F):5'- AGCTTCCTGGACATCTGGAG -3'
(R):5'- CCACATATGTTTGTCCCCTTTG -3'

Posted On

2017-08-16