Incidental Mutation 'R6117:Stk32c'
ID485160
Institutional Source Beutler Lab
Gene Symbol Stk32c
Ensembl Gene ENSMUSG00000015981
Gene Nameserine/threonine kinase 32C
SynonymsYANK3, Pkek
MMRRC Submission 044266-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6117 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location139103638-139213307 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 139122923 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 67 (Q67*)
Ref Sequence ENSEMBL: ENSMUSP00000126638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016125] [ENSMUST00000165870]
Predicted Effect probably null
Transcript: ENSMUST00000016125
AA Change: Q185*
SMART Domains Protein: ENSMUSP00000016125
Gene: ENSMUSG00000015981
AA Change: Q185*

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 32 48 N/A INTRINSIC
low complexity region 62 80 N/A INTRINSIC
S_TKc 94 354 9.16e-82 SMART
low complexity region 398 407 N/A INTRINSIC
low complexity region 408 418 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165870
AA Change: Q67*
SMART Domains Protein: ENSMUSP00000126638
Gene: ENSMUSG00000015981
AA Change: Q67*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 232 1.2e-30 PFAM
Pfam:Pkinase 1 235 1.5e-51 PFAM
Pfam:Kinase-like 12 223 6.2e-13 PFAM
low complexity region 280 289 N/A INTRINSIC
low complexity region 290 300 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. It is thought that this family member is functional in brain due to its high expression levels there. DNA methylation differences have been found in this gene in monozygotic twins that are discordant for adolescent depression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A G 7: 76,698,786 Y625C probably damaging Het
Ankmy1 A G 1: 92,861,274 probably benign Het
Apmap T C 2: 150,600,332 T41A probably benign Het
Cacna1a A G 8: 84,614,721 Y1804C probably damaging Het
Cacna1e A T 1: 154,561,791 I333N possibly damaging Het
Cdsn C A 17: 35,555,034 S153R unknown Het
Celsr1 A T 15: 85,932,411 M1777K probably benign Het
Cmtr1 A G 17: 29,682,165 M249V probably benign Het
Cmya5 A G 13: 93,095,166 L1138P probably damaging Het
Crim1 A C 17: 78,303,088 D324A probably damaging Het
Dmap1 T A 4: 117,675,535 probably null Het
Dnah17 T C 11: 118,119,571 Y307C probably benign Het
Dnah5 T A 15: 28,270,420 L956H probably damaging Het
Enpp3 C T 10: 24,787,852 S537N probably damaging Het
Eya3 T A 4: 132,711,862 L323Q probably damaging Het
Fads3 A T 19: 10,054,267 H226L probably damaging Het
Flrt3 T A 2: 140,660,445 D421V possibly damaging Het
Frmd4a T C 2: 4,602,249 V370A possibly damaging Het
Gapvd1 T C 2: 34,690,459 probably null Het
Gm2178 T C 14: 26,514,840 probably benign Het
Gm5592 A G 7: 41,288,464 N390S probably benign Het
Hoxa10 T A 6: 52,234,820 R39* probably null Het
Kcnj1 A G 9: 32,397,182 T281A probably damaging Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Naip1 T A 13: 100,444,737 M1L probably damaging Het
Olfr1331 A T 4: 118,869,144 Y121F probably benign Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Pcdhb12 G A 18: 37,435,642 probably benign Het
Pde1b T C 15: 103,521,482 V134A probably damaging Het
Plxnb2 A T 15: 89,158,000 D1600E probably benign Het
Prss54 T A 8: 95,565,458 probably null Het
Ryr3 A T 2: 112,635,396 I4757N probably damaging Het
Slc1a6 T C 10: 78,788,988 Y76H possibly damaging Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Sox15 G T 11: 69,655,890 G173V possibly damaging Het
Stard3 T C 11: 98,372,262 S48P probably damaging Het
Svil T A 18: 5,116,016 W2101R probably damaging Het
Taar7e T A 10: 24,038,529 Y306N probably damaging Het
Tarbp1 T A 8: 126,427,541 M1485L probably benign Het
Togaram1 A G 12: 64,967,487 D504G probably damaging Het
Trrap T C 5: 144,802,961 L1091S possibly damaging Het
Unc80 A G 1: 66,675,067 E2856G possibly damaging Het
Usp47 C T 7: 112,087,932 T699M probably damaging Het
Other mutations in Stk32c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Stk32c APN 7 139188153 missense possibly damaging 0.47
IGL02559:Stk32c APN 7 139120690 missense probably benign 0.00
IGL02805:Stk32c APN 7 139121846 missense probably damaging 1.00
R0531:Stk32c UTSW 7 139120720 missense probably damaging 0.97
R0622:Stk32c UTSW 7 139188110 missense probably benign 0.00
R1140:Stk32c UTSW 7 139125179 missense probably damaging 0.99
R1473:Stk32c UTSW 7 139125179 missense probably damaging 0.99
R1589:Stk32c UTSW 7 139119015 critical splice donor site probably null
R1697:Stk32c UTSW 7 139121824 missense probably benign 0.25
R1855:Stk32c UTSW 7 139121447 missense probably damaging 0.97
R4290:Stk32c UTSW 7 139120788 critical splice acceptor site probably null
R4293:Stk32c UTSW 7 139120788 critical splice acceptor site probably null
R4295:Stk32c UTSW 7 139120788 critical splice acceptor site probably null
R5323:Stk32c UTSW 7 139119360 missense probably benign 0.07
R5854:Stk32c UTSW 7 139188279 intron probably benign
R5907:Stk32c UTSW 7 139120674 missense probably benign 0.32
R6115:Stk32c UTSW 7 139120712 nonsense probably null
R6176:Stk32c UTSW 7 139120775 missense probably benign 0.02
R6460:Stk32c UTSW 7 139105274 missense probably damaging 1.00
R6695:Stk32c UTSW 7 139122964 missense probably damaging 1.00
R6745:Stk32c UTSW 7 139122893 missense probably damaging 0.99
R7177:Stk32c UTSW 7 139104302 missense possibly damaging 0.62
R7676:Stk32c UTSW 7 139105304 missense possibly damaging 0.87
R7721:Stk32c UTSW 7 139188153 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CTCTGCGTCCATCCTCAAAG -3'
(R):5'- CAGGATGGTGATCAGACTGG -3'

Sequencing Primer
(F):5'- GTCCATCCTCAAAGTGGGTAG -3'
(R):5'- TGGTGATCAGACTGGAAGGAG -3'
Posted On2017-08-16