Mutagenetix > Incidental Mutation

Incidental Mutation 'R6117:Tarbp1'

485164

Institutional Source

Beutler Lab

Gene Symbol

Tarbp1

Ensembl Gene

ENSMUSG00000090290

Gene Name

TAR RNA binding protein 1

Synonyms

Gm17296

MMRRC Submission

044266-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6117 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

126425329-126475065 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 126427541 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1485 (M1485L)

Ref Sequence

ENSEMBL: ENSMUSP00000129815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059093] [ENSMUST00000170518] [ENSMUST00000211868]

AlphaFold

E9Q368

Predicted Effect

probably benign
Transcript: ENSMUST00000059093

SMART Domains

Protein: ENSMUSP00000058279
Gene: ENSMUSG00000051671

Domain	Start	End	E-Value	Type
Pfam:COX6B	1	67	6e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170518
AA Change: M1485L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000129815
Gene: ENSMUSG00000090290
AA Change: M1485L

Domain	Start	End	E-Value	Type
low complexity region	17	31	N/A	INTRINSIC
low complexity region	47	57	N/A	INTRINSIC
low complexity region	77	97	N/A	INTRINSIC
low complexity region	112	127	N/A	INTRINSIC
low complexity region	195	207	N/A	INTRINSIC
SCOP:d1gw5a_	1059	1260	3e-3	SMART
Pfam:SpoU_methylase	1421	1564	2.2e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211868

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. This element forms a stable stem-loop structure and can be bound by either the protein encoded by this gene or by RNA polymerase II. This protein may act to disengage RNA polymerase II from TAR during transcriptional elongation. Alternatively spliced transcripts of this gene may exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agbl1	A	G	7: 76,698,786	Y625C	probably damaging	Het
Ankmy1	A	G	1: 92,861,274		probably benign	Het
Apmap	T	C	2: 150,600,332	T41A	probably benign	Het
Cacna1a	A	G	8: 84,614,721	Y1804C	probably damaging	Het
Cacna1e	A	T	1: 154,561,791	I333N	possibly damaging	Het
Cdsn	C	A	17: 35,555,034	S153R	unknown	Het
Celsr1	A	T	15: 85,932,411	M1777K	probably benign	Het
Cmtr1	A	G	17: 29,682,165	M249V	probably benign	Het
Cmya5	A	G	13: 93,095,166	L1138P	probably damaging	Het
Crim1	A	C	17: 78,303,088	D324A	probably damaging	Het
Dmap1	T	A	4: 117,675,535		probably null	Het
Dnah17	T	C	11: 118,119,571	Y307C	probably benign	Het
Dnah5	T	A	15: 28,270,420	L956H	probably damaging	Het
Enpp3	C	T	10: 24,787,852	S537N	probably damaging	Het
Eya3	T	A	4: 132,711,862	L323Q	probably damaging	Het
Fads3	A	T	19: 10,054,267	H226L	probably damaging	Het
Flrt3	T	A	2: 140,660,445	D421V	possibly damaging	Het
Frmd4a	T	C	2: 4,602,249	V370A	possibly damaging	Het
Gapvd1	T	C	2: 34,690,459		probably null	Het
Gm2178	T	C	14: 26,514,840		probably benign	Het
Gm5592	A	G	7: 41,288,464	N390S	probably benign	Het
Hoxa10	T	A	6: 52,234,820	R39*	probably null	Het
Kcnj1	A	G	9: 32,397,182	T281A	probably damaging	Het
Myo10	T	C	15: 25,805,659	Y1709H	probably benign	Het
Nacad	T	C	11: 6,599,810	D1127G	probably benign	Het
Naip1	T	A	13: 100,444,737	M1L	probably damaging	Het
Olfr1331	A	T	4: 118,869,144	Y121F	probably benign	Het
Olfr811	G	A	10: 129,801,820	A235V	probably damaging	Het
Olfr811	C	A	10: 129,801,821	A235S	probably damaging	Het
Pcdhb12	G	A	18: 37,435,642		probably benign	Het
Pde1b	T	C	15: 103,521,482	V134A	probably damaging	Het
Plxnb2	A	T	15: 89,158,000	D1600E	probably benign	Het
Prss54	T	A	8: 95,565,458		probably null	Het
Ryr3	A	T	2: 112,635,396	I4757N	probably damaging	Het
Slc1a6	T	C	10: 78,788,988	Y76H	possibly damaging	Het
Slco3a1	C	T	7: 74,318,506	D489N	probably benign	Het
Sox15	G	T	11: 69,655,890	G173V	possibly damaging	Het
Stard3	T	C	11: 98,372,262	S48P	probably damaging	Het
Stk32c	G	A	7: 139,122,923	Q67*	probably null	Het
Svil	T	A	18: 5,116,016	W2101R	probably damaging	Het
Taar7e	T	A	10: 24,038,529	Y306N	probably damaging	Het
Togaram1	A	G	12: 64,967,487	D504G	probably damaging	Het
Trrap	T	C	5: 144,802,961	L1091S	possibly damaging	Het
Unc80	A	G	1: 66,675,067	E2856G	possibly damaging	Het
Usp47	C	T	7: 112,087,932	T699M	probably damaging	Het

Other mutations in Tarbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00985:Tarbp1	APN	8	126459161	missense	probably damaging	1.00
IGL01419:Tarbp1	APN	8	126428155	missense	probably benign	0.03
IGL01475:Tarbp1	APN	8	126433962	missense	probably benign	0.03
IGL01688:Tarbp1	APN	8	126447551	missense	probably damaging	1.00
IGL01772:Tarbp1	APN	8	126447231	splice site	probably benign
IGL02402:Tarbp1	APN	8	126450828	splice site	probably benign
IGL02899:Tarbp1	APN	8	126453844	missense	probably damaging	0.96
IGL03006:Tarbp1	APN	8	126444142	missense	probably damaging	1.00
IGL03273:Tarbp1	APN	8	126453835	missense	probably damaging	1.00
PIT4280001:Tarbp1	UTSW	8	126430847	missense	probably damaging	0.96
R0048:Tarbp1	UTSW	8	126447530	missense	probably damaging	1.00
R0309:Tarbp1	UTSW	8	126438928	splice site	probably benign
R0383:Tarbp1	UTSW	8	126447484	missense	probably benign	0.00
R0455:Tarbp1	UTSW	8	126440873	missense	probably benign	0.00
R0738:Tarbp1	UTSW	8	126438801	critical splice donor site	probably null
R1345:Tarbp1	UTSW	8	126448330	missense	probably benign	0.03
R1370:Tarbp1	UTSW	8	126448330	missense	probably benign	0.03
R1617:Tarbp1	UTSW	8	126444268	missense	possibly damaging	0.47
R1628:Tarbp1	UTSW	8	126430860	missense	possibly damaging	0.78
R1702:Tarbp1	UTSW	8	126428218	missense	probably damaging	1.00
R1873:Tarbp1	UTSW	8	126447047	missense	probably damaging	1.00
R2018:Tarbp1	UTSW	8	126428114	missense	probably damaging	1.00
R2019:Tarbp1	UTSW	8	126428114	missense	probably damaging	1.00
R2060:Tarbp1	UTSW	8	126447594	splice site	probably null
R2877:Tarbp1	UTSW	8	126427832	missense	probably damaging	1.00
R3008:Tarbp1	UTSW	8	126447421	missense	possibly damaging	0.46
R3875:Tarbp1	UTSW	8	126438799	splice site	probably benign
R3905:Tarbp1	UTSW	8	126428152	missense	probably damaging	1.00
R3923:Tarbp1	UTSW	8	126440771	missense	probably benign	0.00
R4420:Tarbp1	UTSW	8	126447080	missense	possibly damaging	0.59
R4570:Tarbp1	UTSW	8	126452233	missense	probably benign	0.00
R4610:Tarbp1	UTSW	8	126474330	missense	probably damaging	1.00
R4649:Tarbp1	UTSW	8	126447195	missense	probably damaging	0.96
R4802:Tarbp1	UTSW	8	126474889	missense	possibly damaging	0.75
R4951:Tarbp1	UTSW	8	126447445	missense	possibly damaging	0.94
R4953:Tarbp1	UTSW	8	126447445	missense	possibly damaging	0.94
R5254:Tarbp1	UTSW	8	126467156	missense	probably damaging	0.96
R5255:Tarbp1	UTSW	8	126428970	missense	probably benign	0.16
R5638:Tarbp1	UTSW	8	126450686	missense	probably damaging	1.00
R5696:Tarbp1	UTSW	8	126447340	missense	probably damaging	0.98
R5707:Tarbp1	UTSW	8	126467144	missense	probably damaging	1.00
R5896:Tarbp1	UTSW	8	126452928	missense	probably benign	0.05
R6087:Tarbp1	UTSW	8	126428970	missense	probably benign	0.00
R6132:Tarbp1	UTSW	8	126434809	missense	probably benign	0.17
R6168:Tarbp1	UTSW	8	126448405	missense	possibly damaging	0.89
R6419:Tarbp1	UTSW	8	126459044	missense	possibly damaging	0.95
R6482:Tarbp1	UTSW	8	126450695	missense	probably benign	0.01
R6766:Tarbp1	UTSW	8	126447400	missense	probably benign	0.41
R6775:Tarbp1	UTSW	8	126436829	missense	probably benign	0.16
R6960:Tarbp1	UTSW	8	126429039	missense	possibly damaging	0.88
R7054:Tarbp1	UTSW	8	126474495	missense	possibly damaging	0.85
R7068:Tarbp1	UTSW	8	126427034	missense	probably damaging	1.00
R7454:Tarbp1	UTSW	8	126457677	missense	probably benign	0.19
R7519:Tarbp1	UTSW	8	126433900	missense	possibly damaging	0.87
R7760:Tarbp1	UTSW	8	126452807	missense	not run
R7837:Tarbp1	UTSW	8	126474561	missense	probably benign	0.00
R7882:Tarbp1	UTSW	8	126456493	missense	probably damaging	1.00
R7982:Tarbp1	UTSW	8	126444301	missense	probably damaging	1.00
R8166:Tarbp1	UTSW	8	126427128	missense	possibly damaging	0.79
R8517:Tarbp1	UTSW	8	126444195	missense	probably benign	0.29
R8838:Tarbp1	UTSW	8	126450830	splice site	probably benign
R8880:Tarbp1	UTSW	8	126471305	missense	probably damaging	1.00
R9061:Tarbp1	UTSW	8	126447141	missense	probably damaging	1.00
R9123:Tarbp1	UTSW	8	126447463	missense	possibly damaging	0.63
R9125:Tarbp1	UTSW	8	126447463	missense	possibly damaging	0.63
R9364:Tarbp1	UTSW	8	126450723	missense	probably benign	0.01
R9474:Tarbp1	UTSW	8	126429040	missense	probably benign	0.44
R9670:Tarbp1	UTSW	8	126456523	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCAGGTCCCCTTAAAAGC -3'
(R):5'- AGGTTTAGTCTGTGACCTGC -3'

Sequencing Primer
(F):5'- GCAGGTCCCCTTAAAAGCTATAAG -3'
(R):5'- GACCTGCGGTCGTGTGG -3'

Posted On

2017-08-16