Incidental Mutation 'R6117:Kcnj1'
ID485165
Institutional Source Beutler Lab
Gene Symbol Kcnj1
Ensembl Gene ENSMUSG00000041248
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 1
SynonymsKir1.1, ROMK, ROMK-2
MMRRC Submission 044266-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6117 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location32372493-32399197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32397182 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 281 (T281A)
Ref Sequence ENSEMBL: ENSMUSP00000150540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047334] [ENSMUST00000172015] [ENSMUST00000213393]
Predicted Effect probably damaging
Transcript: ENSMUST00000047334
AA Change: T281A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046793
Gene: ENSMUSG00000041248
AA Change: T281A

DomainStartEndE-ValueType
Pfam:IRK 24 361 1.4e-155 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172015
AA Change: T301A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131625
Gene: ENSMUSG00000041248
AA Change: T301A

DomainStartEndE-ValueType
Pfam:IRK 44 373 7.6e-144 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213393
AA Change: T281A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. It is activated by internal ATP and probably plays an important role in potassium homeostasis. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Mutations in this gene have been associated with antenatal Bartter syndrome, which is characterized by salt wasting, hypokalemic alkalosis, hypercalciuria, and low blood pressure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygotes for a null mutation die before weaning with impaired electrolyte, acid-base, and fluid-volume homeostasis, reduced NaCl absorption in the thick ascending limb, and abnormal tubuloglomerular feedback. A colony of mutants with extended suvival serves as a model for Bartter's syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A G 7: 76,698,786 Y625C probably damaging Het
Ankmy1 A G 1: 92,861,274 probably benign Het
Apmap T C 2: 150,600,332 T41A probably benign Het
Cacna1a A G 8: 84,614,721 Y1804C probably damaging Het
Cacna1e A T 1: 154,561,791 I333N possibly damaging Het
Cdsn C A 17: 35,555,034 S153R unknown Het
Celsr1 A T 15: 85,932,411 M1777K probably benign Het
Cmtr1 A G 17: 29,682,165 M249V probably benign Het
Cmya5 A G 13: 93,095,166 L1138P probably damaging Het
Crim1 A C 17: 78,303,088 D324A probably damaging Het
Dmap1 T A 4: 117,675,535 probably null Het
Dnah17 T C 11: 118,119,571 Y307C probably benign Het
Dnah5 T A 15: 28,270,420 L956H probably damaging Het
Enpp3 C T 10: 24,787,852 S537N probably damaging Het
Eya3 T A 4: 132,711,862 L323Q probably damaging Het
Fads3 A T 19: 10,054,267 H226L probably damaging Het
Flrt3 T A 2: 140,660,445 D421V possibly damaging Het
Frmd4a T C 2: 4,602,249 V370A possibly damaging Het
Gapvd1 T C 2: 34,690,459 probably null Het
Gm2178 T C 14: 26,514,840 probably benign Het
Gm5592 A G 7: 41,288,464 N390S probably benign Het
Hoxa10 T A 6: 52,234,820 R39* probably null Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Naip1 T A 13: 100,444,737 M1L probably damaging Het
Olfr1331 A T 4: 118,869,144 Y121F probably benign Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Pcdhb12 G A 18: 37,435,642 probably benign Het
Pde1b T C 15: 103,521,482 V134A probably damaging Het
Plxnb2 A T 15: 89,158,000 D1600E probably benign Het
Prss54 T A 8: 95,565,458 probably null Het
Ryr3 A T 2: 112,635,396 I4757N probably damaging Het
Slc1a6 T C 10: 78,788,988 Y76H possibly damaging Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Sox15 G T 11: 69,655,890 G173V possibly damaging Het
Stard3 T C 11: 98,372,262 S48P probably damaging Het
Stk32c G A 7: 139,122,923 Q67* probably null Het
Svil T A 18: 5,116,016 W2101R probably damaging Het
Taar7e T A 10: 24,038,529 Y306N probably damaging Het
Tarbp1 T A 8: 126,427,541 M1485L probably benign Het
Togaram1 A G 12: 64,967,487 D504G probably damaging Het
Trrap T C 5: 144,802,961 L1091S possibly damaging Het
Unc80 A G 1: 66,675,067 E2856G possibly damaging Het
Usp47 C T 7: 112,087,932 T699M probably damaging Het
Other mutations in Kcnj1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Kcnj1 APN 9 32396498 missense probably benign 0.01
IGL02958:Kcnj1 APN 9 32396555 missense probably damaging 1.00
IGL03285:Kcnj1 APN 9 32396861 missense possibly damaging 0.67
R1179:Kcnj1 UTSW 9 32396766 missense probably damaging 0.96
R1503:Kcnj1 UTSW 9 32396492 missense probably damaging 0.98
R1918:Kcnj1 UTSW 9 32396738 missense probably benign 0.00
R4439:Kcnj1 UTSW 9 32394118 intron probably benign
R4659:Kcnj1 UTSW 9 32394148 missense probably benign
R4661:Kcnj1 UTSW 9 32396622 missense probably benign 0.14
R4917:Kcnj1 UTSW 9 32396760 missense probably damaging 0.99
R4918:Kcnj1 UTSW 9 32396760 missense probably damaging 0.99
R5385:Kcnj1 UTSW 9 32396723 missense probably damaging 1.00
R6017:Kcnj1 UTSW 9 32394104 intron probably benign
R6036:Kcnj1 UTSW 9 32397125 missense probably benign 0.15
R6036:Kcnj1 UTSW 9 32397125 missense probably benign 0.15
R6245:Kcnj1 UTSW 9 32396867 missense probably damaging 1.00
R6316:Kcnj1 UTSW 9 32397336 missense probably damaging 0.96
R6585:Kcnj1 UTSW 9 32397261 missense probably benign
R6988:Kcnj1 UTSW 9 32396585 missense probably benign 0.17
R7116:Kcnj1 UTSW 9 32396981 missense possibly damaging 0.91
R7393:Kcnj1 UTSW 9 32397018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAGTCACATATATGGTAAGC -3'
(R):5'- ACAATGAGGGGTCTCCACTTC -3'

Sequencing Primer
(F):5'- GGTAAGCTTCTGAAGACTACCATC -3'
(R):5'- CCACCGTCTTACCAAAGTTATGG -3'
Posted On2017-08-16