Incidental Mutation 'R6117:Taar7e'
ID485166
Institutional Source Beutler Lab
Gene Symbol Taar7e
Ensembl Gene ENSMUSG00000100689
Gene Nametrace amine-associated receptor 7E
SynonymsLOC276742
MMRRC Submission 044266-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R6117 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location24037614-24038690 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24038529 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 306 (Y306N)
Ref Sequence ENSEMBL: ENSMUSP00000090326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092656]
Predicted Effect probably damaging
Transcript: ENSMUST00000092656
AA Change: Y306N

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090326
Gene: ENSMUSG00000100689
AA Change: Y306N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 56 261 5.4e-8 PFAM
Pfam:7TM_GPCR_Srsx 58 341 4.3e-10 PFAM
Pfam:7tm_1 64 326 9.4e-59 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A G 7: 76,698,786 Y625C probably damaging Het
Ankmy1 A G 1: 92,861,274 probably benign Het
Apmap T C 2: 150,600,332 T41A probably benign Het
Cacna1a A G 8: 84,614,721 Y1804C probably damaging Het
Cacna1e A T 1: 154,561,791 I333N possibly damaging Het
Cdsn C A 17: 35,555,034 S153R unknown Het
Celsr1 A T 15: 85,932,411 M1777K probably benign Het
Cmtr1 A G 17: 29,682,165 M249V probably benign Het
Cmya5 A G 13: 93,095,166 L1138P probably damaging Het
Crim1 A C 17: 78,303,088 D324A probably damaging Het
Dmap1 T A 4: 117,675,535 probably null Het
Dnah17 T C 11: 118,119,571 Y307C probably benign Het
Dnah5 T A 15: 28,270,420 L956H probably damaging Het
Enpp3 C T 10: 24,787,852 S537N probably damaging Het
Eya3 T A 4: 132,711,862 L323Q probably damaging Het
Fads3 A T 19: 10,054,267 H226L probably damaging Het
Flrt3 T A 2: 140,660,445 D421V possibly damaging Het
Frmd4a T C 2: 4,602,249 V370A possibly damaging Het
Gapvd1 T C 2: 34,690,459 probably null Het
Gm2178 T C 14: 26,514,840 probably benign Het
Gm5592 A G 7: 41,288,464 N390S probably benign Het
Hoxa10 T A 6: 52,234,820 R39* probably null Het
Kcnj1 A G 9: 32,397,182 T281A probably damaging Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Naip1 T A 13: 100,444,737 M1L probably damaging Het
Olfr1331 A T 4: 118,869,144 Y121F probably benign Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Pcdhb12 G A 18: 37,435,642 probably benign Het
Pde1b T C 15: 103,521,482 V134A probably damaging Het
Plxnb2 A T 15: 89,158,000 D1600E probably benign Het
Prss54 T A 8: 95,565,458 probably null Het
Ryr3 A T 2: 112,635,396 I4757N probably damaging Het
Slc1a6 T C 10: 78,788,988 Y76H possibly damaging Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Sox15 G T 11: 69,655,890 G173V possibly damaging Het
Stard3 T C 11: 98,372,262 S48P probably damaging Het
Stk32c G A 7: 139,122,923 Q67* probably null Het
Svil T A 18: 5,116,016 W2101R probably damaging Het
Tarbp1 T A 8: 126,427,541 M1485L probably benign Het
Togaram1 A G 12: 64,967,487 D504G probably damaging Het
Trrap T C 5: 144,802,961 L1091S possibly damaging Het
Unc80 A G 1: 66,675,067 E2856G possibly damaging Het
Usp47 C T 7: 112,087,932 T699M probably damaging Het
Other mutations in Taar7e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Taar7e APN 10 24038140 missense probably benign
IGL03150:Taar7e APN 10 24037630 missense probably benign 0.01
IGL03366:Taar7e APN 10 24037915 missense probably damaging 1.00
R2013:Taar7e UTSW 10 24037834 missense possibly damaging 0.63
R2095:Taar7e UTSW 10 24038051 nonsense probably null
R4210:Taar7e UTSW 10 24038034 missense probably damaging 1.00
R4211:Taar7e UTSW 10 24038034 missense probably damaging 1.00
R4766:Taar7e UTSW 10 24038566 missense probably damaging 0.99
R6085:Taar7e UTSW 10 24037863 missense probably benign 0.03
R6918:Taar7e UTSW 10 24037615 start codon destroyed probably null 0.15
R7410:Taar7e UTSW 10 24038526 missense probably benign
R7913:Taar7e UTSW 10 24038004 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ATTGCTAAACAGCAGGCTCAG -3'
(R):5'- GTGAGTCTCTCCAATCCCCAAC -3'

Sequencing Primer
(F):5'- ACAGCAGGCTCAGAACATTG -3'
(R):5'- TGAGTCTCTCCAATCCCCAACTAAAC -3'
Posted On2017-08-16