Incidental Mutation 'R6117:Myo10'
ID485180
Institutional Source Beutler Lab
Gene Symbol Myo10
Ensembl Gene ENSMUSG00000022272
Gene Namemyosin X
SynonymsD15Ertd600e, myosin-X
MMRRC Submission 044266-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6117 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location25622525-25813673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25805659 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1709 (Y1709H)
Ref Sequence ENSEMBL: ENSMUSP00000106087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022882] [ENSMUST00000110457]
Predicted Effect probably benign
Transcript: ENSMUST00000022882
AA Change: Y963H

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000022882
Gene: ENSMUSG00000022272
AA Change: Y963H

DomainStartEndE-ValueType
IQ 1 17 7.83e1 SMART
IQ 18 40 1.06e0 SMART
IQ 41 63 7.07e-2 SMART
PDB:2LW9|B 136 171 7e-13 PDB
low complexity region 172 186 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 344 356 N/A INTRINSIC
low complexity region 401 419 N/A INTRINSIC
PH 471 570 1.39e-21 SMART
SCOP:d1faoa_ 588 639 3e-6 SMART
PH 651 757 6.76e-11 SMART
MyTH4 805 953 4.12e-37 SMART
B41 954 1216 1.72e-44 SMART
Blast:B41 1218 1303 3e-45 BLAST
low complexity region 1304 1316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110457
AA Change: Y1709H

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000106087
Gene: ENSMUSG00000022272
AA Change: Y1709H

DomainStartEndE-ValueType
MYSc 57 740 N/A SMART
IQ 741 763 1.27e-3 SMART
IQ 764 786 1.06e0 SMART
IQ 787 809 7.07e-2 SMART
Pfam:MYO10_CC 881 932 4.2e-22 PFAM
low complexity region 959 981 N/A INTRINSIC
low complexity region 1090 1102 N/A INTRINSIC
low complexity region 1147 1165 N/A INTRINSIC
PH 1217 1316 1.39e-21 SMART
PH 1397 1503 6.76e-11 SMART
MyTH4 1551 1699 4.12e-37 SMART
B41 1700 1962 1.72e-44 SMART
low complexity region 2050 2062 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-10 (MYH10). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. This gene functions as an actin-based molecular motor and plays a role in integration of F-actin and microtubule cytoskeletons during meiosis. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutations are semi-lethal with over half of homozygous embryos exhibiting exencephaly. Surviving mutants show decreased body weight, white spotting, syndactyly, persistence of hyaloid vascular system and other eye defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A G 7: 76,698,786 Y625C probably damaging Het
Ankmy1 A G 1: 92,861,274 probably benign Het
Apmap T C 2: 150,600,332 T41A probably benign Het
Cacna1a A G 8: 84,614,721 Y1804C probably damaging Het
Cacna1e A T 1: 154,561,791 I333N possibly damaging Het
Cdsn C A 17: 35,555,034 S153R unknown Het
Celsr1 A T 15: 85,932,411 M1777K probably benign Het
Cmtr1 A G 17: 29,682,165 M249V probably benign Het
Cmya5 A G 13: 93,095,166 L1138P probably damaging Het
Crim1 A C 17: 78,303,088 D324A probably damaging Het
Dmap1 T A 4: 117,675,535 probably null Het
Dnah17 T C 11: 118,119,571 Y307C probably benign Het
Dnah5 T A 15: 28,270,420 L956H probably damaging Het
Enpp3 C T 10: 24,787,852 S537N probably damaging Het
Eya3 T A 4: 132,711,862 L323Q probably damaging Het
Fads3 A T 19: 10,054,267 H226L probably damaging Het
Flrt3 T A 2: 140,660,445 D421V possibly damaging Het
Frmd4a T C 2: 4,602,249 V370A possibly damaging Het
Gapvd1 T C 2: 34,690,459 probably null Het
Gm2178 T C 14: 26,514,840 probably benign Het
Gm5592 A G 7: 41,288,464 N390S probably benign Het
Hoxa10 T A 6: 52,234,820 R39* probably null Het
Kcnj1 A G 9: 32,397,182 T281A probably damaging Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Naip1 T A 13: 100,444,737 M1L probably damaging Het
Olfr1331 A T 4: 118,869,144 Y121F probably benign Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Pcdhb12 G A 18: 37,435,642 probably benign Het
Pde1b T C 15: 103,521,482 V134A probably damaging Het
Plxnb2 A T 15: 89,158,000 D1600E probably benign Het
Prss54 T A 8: 95,565,458 probably null Het
Ryr3 A T 2: 112,635,396 I4757N probably damaging Het
Slc1a6 T C 10: 78,788,988 Y76H possibly damaging Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Sox15 G T 11: 69,655,890 G173V possibly damaging Het
Stard3 T C 11: 98,372,262 S48P probably damaging Het
Stk32c G A 7: 139,122,923 Q67* probably null Het
Svil T A 18: 5,116,016 W2101R probably damaging Het
Taar7e T A 10: 24,038,529 Y306N probably damaging Het
Tarbp1 T A 8: 126,427,541 M1485L probably benign Het
Togaram1 A G 12: 64,967,487 D504G probably damaging Het
Trrap T C 5: 144,802,961 L1091S possibly damaging Het
Unc80 A G 1: 66,675,067 E2856G possibly damaging Het
Usp47 C T 7: 112,087,932 T699M probably damaging Het
Other mutations in Myo10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Myo10 APN 15 25776380 missense probably damaging 1.00
IGL01068:Myo10 APN 15 25739309 missense possibly damaging 0.93
IGL01352:Myo10 APN 15 25701697 missense probably damaging 1.00
IGL01388:Myo10 APN 15 25736617 missense possibly damaging 0.55
IGL01460:Myo10 APN 15 25714108 missense probably benign 0.00
IGL01553:Myo10 APN 15 25776329 missense probably damaging 1.00
IGL01732:Myo10 APN 15 25732063 missense probably benign 0.10
IGL01992:Myo10 APN 15 25799548 missense possibly damaging 0.92
IGL02000:Myo10 APN 15 25808066 missense probably damaging 1.00
IGL02045:Myo10 APN 15 25726488 missense probably benign 0.03
IGL02307:Myo10 APN 15 25776315 splice site probably benign
IGL02511:Myo10 APN 15 25723889 missense probably damaging 0.97
IGL03240:Myo10 APN 15 25701602 missense probably damaging 1.00
least UTSW 15 25726475 nonsense probably null
R0037:Myo10 UTSW 15 25666532 intron probably benign
R0153:Myo10 UTSW 15 25781238 missense possibly damaging 0.84
R0282:Myo10 UTSW 15 25793167 missense probably damaging 1.00
R0360:Myo10 UTSW 15 25804368 missense probably damaging 1.00
R0585:Myo10 UTSW 15 25736455 missense probably damaging 1.00
R0617:Myo10 UTSW 15 25738005 missense probably damaging 1.00
R0729:Myo10 UTSW 15 25722157 splice site probably benign
R0771:Myo10 UTSW 15 25778178 missense probably damaging 1.00
R0960:Myo10 UTSW 15 25801189 missense probably damaging 1.00
R1562:Myo10 UTSW 15 25780411 missense possibly damaging 0.81
R1651:Myo10 UTSW 15 25742369 missense probably damaging 1.00
R1789:Myo10 UTSW 15 25726525 critical splice donor site probably null
R1816:Myo10 UTSW 15 25800200 missense probably damaging 1.00
R1835:Myo10 UTSW 15 25805587 missense possibly damaging 0.53
R1908:Myo10 UTSW 15 25801222 missense probably damaging 1.00
R2082:Myo10 UTSW 15 25785993 missense probably damaging 1.00
R2101:Myo10 UTSW 15 25722259 missense probably benign 0.26
R2129:Myo10 UTSW 15 25781799 missense probably benign 0.09
R2141:Myo10 UTSW 15 25714108 missense probably benign
R2142:Myo10 UTSW 15 25714108 missense probably benign
R2920:Myo10 UTSW 15 25801140 missense probably damaging 1.00
R2938:Myo10 UTSW 15 25795717 missense probably damaging 0.99
R3723:Myo10 UTSW 15 25803288 missense probably damaging 1.00
R3852:Myo10 UTSW 15 25779626 missense probably damaging 1.00
R4162:Myo10 UTSW 15 25726415 splice site probably null
R4163:Myo10 UTSW 15 25726415 splice site probably null
R4164:Myo10 UTSW 15 25726415 splice site probably null
R4177:Myo10 UTSW 15 25734051 missense possibly damaging 0.81
R4409:Myo10 UTSW 15 25807869 missense probably damaging 1.00
R4667:Myo10 UTSW 15 25793153 missense possibly damaging 0.91
R4905:Myo10 UTSW 15 25800212 missense probably damaging 0.99
R4933:Myo10 UTSW 15 25781118 missense probably damaging 0.96
R4968:Myo10 UTSW 15 25808184 missense probably damaging 1.00
R5081:Myo10 UTSW 15 25785940 missense probably damaging 1.00
R5123:Myo10 UTSW 15 25726483 missense possibly damaging 0.94
R5310:Myo10 UTSW 15 25778078 splice site probably null
R6073:Myo10 UTSW 15 25736642 missense probably damaging 1.00
R6185:Myo10 UTSW 15 25726510 missense probably damaging 0.99
R6749:Myo10 UTSW 15 25714110 missense probably damaging 1.00
R6819:Myo10 UTSW 15 25781410 missense possibly damaging 0.80
R6875:Myo10 UTSW 15 25805659 missense probably benign 0.00
R6908:Myo10 UTSW 15 25804383 missense probably damaging 1.00
R6963:Myo10 UTSW 15 25734063 missense probably benign 0.31
R7144:Myo10 UTSW 15 25723925 missense probably damaging 1.00
R7266:Myo10 UTSW 15 25782981 missense probably damaging 1.00
R7380:Myo10 UTSW 15 25779620 missense probably benign 0.01
R7460:Myo10 UTSW 15 25807827 missense probably damaging 1.00
R7614:Myo10 UTSW 15 25701623 missense probably benign 0.00
R7618:Myo10 UTSW 15 25726475 nonsense probably null
R7717:Myo10 UTSW 15 25731970 missense probably benign 0.01
R7811:Myo10 UTSW 15 25804524 missense probably damaging 1.00
R7830:Myo10 UTSW 15 25737971 nonsense probably null
R7862:Myo10 UTSW 15 25666436 missense probably damaging 1.00
R8232:Myo10 UTSW 15 25804314 missense possibly damaging 0.89
R8264:Myo10 UTSW 15 25800109 missense probably damaging 0.99
R8377:Myo10 UTSW 15 25804395 missense possibly damaging 0.94
R8385:Myo10 UTSW 15 25804398 missense probably damaging 1.00
R8426:Myo10 UTSW 15 25799490 missense probably damaging 0.99
R8439:Myo10 UTSW 15 25725072 missense probably benign 0.00
RF013:Myo10 UTSW 15 25799479 missense probably damaging 0.99
Z1177:Myo10 UTSW 15 25781401 missense probably damaging 1.00
Z1177:Myo10 UTSW 15 25799554 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATTCACTCCTGTCACCACAAGG -3'
(R):5'- ACTGACTTCCTTGCTTGTTGAG -3'

Sequencing Primer
(F):5'- GGCCAGCCTGTGTCTATC -3'
(R):5'- CTTGTTGAGCGGATACACTGAGC -3'
Posted On2017-08-16