Incidental Mutation 'R6117:Pde1b'
ID485184
Institutional Source Beutler Lab
Gene Symbol Pde1b
Ensembl Gene ENSMUSG00000022489
Gene Namephosphodiesterase 1B, Ca2+-calmodulin dependent
Synonyms
MMRRC Submission 044266-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6117 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location103503034-103530052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103521482 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 134 (V134A)
Ref Sequence ENSEMBL: ENSMUSP00000023132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023132] [ENSMUST00000226468] [ENSMUST00000226493] [ENSMUST00000227955]
Predicted Effect probably damaging
Transcript: ENSMUST00000023132
AA Change: V134A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023132
Gene: ENSMUSG00000022489
AA Change: V134A

DomainStartEndE-ValueType
coiled coil region 38 60 N/A INTRINSIC
Pfam:PDEase_I_N 76 136 1.2e-33 PFAM
HDc 219 383 8.77e-5 SMART
Blast:HDc 394 443 1e-20 BLAST
low complexity region 467 478 N/A INTRINSIC
low complexity region 511 527 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226468
AA Change: V134A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000226493
AA Change: V134A

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227925
Predicted Effect probably benign
Transcript: ENSMUST00000227955
AA Change: V115A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE1 subfamily. Members of the PDE1 family are calmodulin-dependent PDEs that are stimulated by a calcium-calmodulin complex. This PDE has dual-specificity for the second messengers, cAMP and cGMP, with a preference for cGMP as a substrate. cAMP and cGMP function as key regulators of many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased exploratory behavior. Learning deficits and hyperactivity are also observed in some situations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A G 7: 76,698,786 Y625C probably damaging Het
Ankmy1 A G 1: 92,861,274 probably benign Het
Apmap T C 2: 150,600,332 T41A probably benign Het
Cacna1a A G 8: 84,614,721 Y1804C probably damaging Het
Cacna1e A T 1: 154,561,791 I333N possibly damaging Het
Cdsn C A 17: 35,555,034 S153R unknown Het
Celsr1 A T 15: 85,932,411 M1777K probably benign Het
Cmtr1 A G 17: 29,682,165 M249V probably benign Het
Cmya5 A G 13: 93,095,166 L1138P probably damaging Het
Crim1 A C 17: 78,303,088 D324A probably damaging Het
Dmap1 T A 4: 117,675,535 probably null Het
Dnah17 T C 11: 118,119,571 Y307C probably benign Het
Dnah5 T A 15: 28,270,420 L956H probably damaging Het
Enpp3 C T 10: 24,787,852 S537N probably damaging Het
Eya3 T A 4: 132,711,862 L323Q probably damaging Het
Fads3 A T 19: 10,054,267 H226L probably damaging Het
Flrt3 T A 2: 140,660,445 D421V possibly damaging Het
Frmd4a T C 2: 4,602,249 V370A possibly damaging Het
Gapvd1 T C 2: 34,690,459 probably null Het
Gm2178 T C 14: 26,514,840 probably benign Het
Gm5592 A G 7: 41,288,464 N390S probably benign Het
Hoxa10 T A 6: 52,234,820 R39* probably null Het
Kcnj1 A G 9: 32,397,182 T281A probably damaging Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Naip1 T A 13: 100,444,737 M1L probably damaging Het
Olfr1331 A T 4: 118,869,144 Y121F probably benign Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Pcdhb12 G A 18: 37,435,642 probably benign Het
Plxnb2 A T 15: 89,158,000 D1600E probably benign Het
Prss54 T A 8: 95,565,458 probably null Het
Ryr3 A T 2: 112,635,396 I4757N probably damaging Het
Slc1a6 T C 10: 78,788,988 Y76H possibly damaging Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Sox15 G T 11: 69,655,890 G173V possibly damaging Het
Stard3 T C 11: 98,372,262 S48P probably damaging Het
Stk32c G A 7: 139,122,923 Q67* probably null Het
Svil T A 18: 5,116,016 W2101R probably damaging Het
Taar7e T A 10: 24,038,529 Y306N probably damaging Het
Tarbp1 T A 8: 126,427,541 M1485L probably benign Het
Togaram1 A G 12: 64,967,487 D504G probably damaging Het
Trrap T C 5: 144,802,961 L1091S possibly damaging Het
Unc80 A G 1: 66,675,067 E2856G possibly damaging Het
Usp47 C T 7: 112,087,932 T699M probably damaging Het
Other mutations in Pde1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Pde1b APN 15 103526680 missense probably damaging 1.00
IGL01539:Pde1b APN 15 103525345 splice site probably benign
IGL01988:Pde1b APN 15 103524856 unclassified probably null
IGL02380:Pde1b APN 15 103519990 missense possibly damaging 0.80
IGL02424:Pde1b APN 15 103528219 splice site probably benign
IGL02710:Pde1b APN 15 103522057 missense probably damaging 1.00
R0111:Pde1b UTSW 15 103503513 missense probably benign
R1302:Pde1b UTSW 15 103527599 missense probably benign 0.12
R1312:Pde1b UTSW 15 103526273 missense possibly damaging 0.71
R1449:Pde1b UTSW 15 103525043 missense probably damaging 0.99
R1631:Pde1b UTSW 15 103521672 missense probably damaging 0.97
R1848:Pde1b UTSW 15 103525340 splice site probably null
R4032:Pde1b UTSW 15 103521326 missense probably damaging 1.00
R4896:Pde1b UTSW 15 103521374 missense probably damaging 1.00
R4901:Pde1b UTSW 15 103526685 missense probably null 0.92
R5052:Pde1b UTSW 15 103527648 missense possibly damaging 0.76
R5935:Pde1b UTSW 15 103521439 missense possibly damaging 0.81
R7092:Pde1b UTSW 15 103527031 missense probably benign 0.02
R7116:Pde1b UTSW 15 103528318 missense possibly damaging 0.82
R7270:Pde1b UTSW 15 103521655 missense possibly damaging 0.76
R7359:Pde1b UTSW 15 103521325 missense probably damaging 1.00
R7464:Pde1b UTSW 15 103524829 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAGCTGTGACTTTCCTTCTGG -3'
(R):5'- CACAGAGGTATACGTTCTCCGG -3'

Sequencing Primer
(F):5'- TGGTCCTCAGGCAAATCCTAG -3'
(R):5'- TCCGGAACATCCTGAGAAAGAAC -3'
Posted On2017-08-16