Incidental Mutation 'R6117:Cmtr1'
ID485185
Institutional Source Beutler Lab
Gene Symbol Cmtr1
Ensembl Gene ENSMUSG00000024019
Gene Namecap methyltransferase 1
SynonymsFtsjd2, 1300018I05Rik
MMRRC Submission 044266-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R6117 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location29660595-29705979 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29682165 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 249 (M249V)
Ref Sequence ENSEMBL: ENSMUSP00000024816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024816] [ENSMUST00000129864] [ENSMUST00000130871]
Predicted Effect probably benign
Transcript: ENSMUST00000024816
AA Change: M249V

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000024816
Gene: ENSMUSG00000024019
AA Change: M249V

DomainStartEndE-ValueType
G_patch 84 130 1.93e-10 SMART
Pfam:FtsJ 231 448 9.5e-42 PFAM
SCOP:d1ckma2 625 718 4e-3 SMART
WW 752 785 2.05e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128410
Predicted Effect silent
Transcript: ENSMUST00000129864
SMART Domains Protein: ENSMUSP00000134356
Gene: ENSMUSG00000024019

DomainStartEndE-ValueType
PDB:4N4A|A 1 68 2e-40 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130052
Predicted Effect probably benign
Transcript: ENSMUST00000130871
AA Change: M689V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000117838
Gene: ENSMUSG00000098374
AA Change: M689V

DomainStartEndE-ValueType
FHA 37 92 5.55e-8 SMART
low complexity region 116 130 N/A INTRINSIC
low complexity region 299 317 N/A INTRINSIC
RING 406 443 3.64e-7 SMART
G_patch 524 570 1.93e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172610
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A G 7: 76,698,786 Y625C probably damaging Het
Ankmy1 A G 1: 92,861,274 probably benign Het
Apmap T C 2: 150,600,332 T41A probably benign Het
Cacna1a A G 8: 84,614,721 Y1804C probably damaging Het
Cacna1e A T 1: 154,561,791 I333N possibly damaging Het
Cdsn C A 17: 35,555,034 S153R unknown Het
Celsr1 A T 15: 85,932,411 M1777K probably benign Het
Cmya5 A G 13: 93,095,166 L1138P probably damaging Het
Crim1 A C 17: 78,303,088 D324A probably damaging Het
Dmap1 T A 4: 117,675,535 probably null Het
Dnah17 T C 11: 118,119,571 Y307C probably benign Het
Dnah5 T A 15: 28,270,420 L956H probably damaging Het
Enpp3 C T 10: 24,787,852 S537N probably damaging Het
Eya3 T A 4: 132,711,862 L323Q probably damaging Het
Fads3 A T 19: 10,054,267 H226L probably damaging Het
Flrt3 T A 2: 140,660,445 D421V possibly damaging Het
Frmd4a T C 2: 4,602,249 V370A possibly damaging Het
Gapvd1 T C 2: 34,690,459 probably null Het
Gm2178 T C 14: 26,514,840 probably benign Het
Gm5592 A G 7: 41,288,464 N390S probably benign Het
Hoxa10 T A 6: 52,234,820 R39* probably null Het
Kcnj1 A G 9: 32,397,182 T281A probably damaging Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Naip1 T A 13: 100,444,737 M1L probably damaging Het
Olfr1331 A T 4: 118,869,144 Y121F probably benign Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Pcdhb12 G A 18: 37,435,642 probably benign Het
Pde1b T C 15: 103,521,482 V134A probably damaging Het
Plxnb2 A T 15: 89,158,000 D1600E probably benign Het
Prss54 T A 8: 95,565,458 probably null Het
Ryr3 A T 2: 112,635,396 I4757N probably damaging Het
Slc1a6 T C 10: 78,788,988 Y76H possibly damaging Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Sox15 G T 11: 69,655,890 G173V possibly damaging Het
Stard3 T C 11: 98,372,262 S48P probably damaging Het
Stk32c G A 7: 139,122,923 Q67* probably null Het
Svil T A 18: 5,116,016 W2101R probably damaging Het
Taar7e T A 10: 24,038,529 Y306N probably damaging Het
Tarbp1 T A 8: 126,427,541 M1485L probably benign Het
Togaram1 A G 12: 64,967,487 D504G probably damaging Het
Trrap T C 5: 144,802,961 L1091S possibly damaging Het
Unc80 A G 1: 66,675,067 E2856G possibly damaging Het
Usp47 C T 7: 112,087,932 T699M probably damaging Het
Other mutations in Cmtr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Cmtr1 APN 17 29674262 missense probably damaging 0.99
IGL00980:Cmtr1 APN 17 29691284 missense probably benign 0.00
IGL00987:Cmtr1 APN 17 29697169 missense probably benign 0.01
IGL01413:Cmtr1 APN 17 29697982 missense probably benign 0.00
IGL01481:Cmtr1 APN 17 29698657 missense probably benign 0.02
IGL02281:Cmtr1 APN 17 29691281 missense probably benign 0.00
IGL03079:Cmtr1 APN 17 29663293 missense possibly damaging 0.71
IGL03376:Cmtr1 APN 17 29691411 missense probably benign 0.00
PIT4403001:Cmtr1 UTSW 17 29698073 critical splice donor site probably null
R0256:Cmtr1 UTSW 17 29697124 missense probably damaging 1.00
R0505:Cmtr1 UTSW 17 29676285 missense probably benign 0.17
R1477:Cmtr1 UTSW 17 29697157 missense possibly damaging 0.63
R1623:Cmtr1 UTSW 17 29687047 splice site probably null
R1852:Cmtr1 UTSW 17 29702255 missense probably benign 0.32
R1867:Cmtr1 UTSW 17 29674174 missense probably benign 0.36
R1918:Cmtr1 UTSW 17 29679009 missense possibly damaging 0.63
R2070:Cmtr1 UTSW 17 29694783 critical splice acceptor site probably null
R2071:Cmtr1 UTSW 17 29694783 critical splice acceptor site probably null
R2161:Cmtr1 UTSW 17 29702173 missense probably benign 0.03
R2518:Cmtr1 UTSW 17 29681980 nonsense probably null
R2763:Cmtr1 UTSW 17 29680628 missense possibly damaging 0.89
R4077:Cmtr1 UTSW 17 29685975 missense probably damaging 1.00
R4271:Cmtr1 UTSW 17 29697982 missense probably benign 0.00
R4363:Cmtr1 UTSW 17 29674232 missense probably damaging 1.00
R4723:Cmtr1 UTSW 17 29687157 splice site probably null
R4736:Cmtr1 UTSW 17 29700242 missense possibly damaging 0.94
R5056:Cmtr1 UTSW 17 29690328 missense possibly damaging 0.64
R5492:Cmtr1 UTSW 17 29690342 missense probably damaging 1.00
R5704:Cmtr1 UTSW 17 29663243 missense possibly damaging 0.95
R5990:Cmtr1 UTSW 17 29702161 missense probably benign
R6050:Cmtr1 UTSW 17 29682134 missense probably damaging 1.00
R6238:Cmtr1 UTSW 17 29682148 missense probably damaging 1.00
R7199:Cmtr1 UTSW 17 29676200 missense probably benign
R7229:Cmtr1 UTSW 17 29695424 critical splice acceptor site probably null
R8337:Cmtr1 UTSW 17 29674177 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CGAGGCGTCTTCTTCCTAAAC -3'
(R):5'- ATGACCCTGCTGAAATCACAG -3'

Sequencing Primer
(F):5'- AGGCGTCTTCTTCCTAAACAGGTG -3'
(R):5'- AATCACAGATCTTTGGGGCC -3'
Posted On2017-08-16