Mutagenetix > Incidental Mutations

Incidental Mutation 'R6117:Crim1'

List |< first << previous [record 10 of 46] next >> last >|

485187

Institutional Source

Beutler Lab

Gene Symbol

Crim1

Ensembl Gene

ENSMUSG00000024074

Gene Name

cysteine rich transmembrane BMP regulator 1 (chordin like)

Synonyms

MMRRC Submission

044266-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6117 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

78200248-78376592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 78303088 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 324 (D324A)

Ref Sequence

ENSEMBL: ENSMUSP00000108117 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112498]

Predicted Effect

probably damaging
Transcript: ENSMUST00000112498
AA Change: D324A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: D324A

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
IB	35	111	1.87e-5	SMART
VWC	336	390	6.04e-13	SMART
VWC	403	456	1.15e-9	SMART
Pfam:Antistasin	469	498	4.5e-10	PFAM
Pfam:Antistasin	505	532	1.5e-8	PFAM
Pfam:Antistasin	539	564	5.7e-9	PFAM
Pfam:Antistasin	567	592	1.7e-10	PFAM
VWC	608	662	1.26e-10	SMART
VWC	679	734	1.37e-11	SMART
VWC	753	808	1.46e-11	SMART
VWC	819	873	1.01e-14	SMART
transmembrane domain	940	962	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175238

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agbl1	A	G	7: 76,698,786	Y625C	probably damaging	Het
Ankmy1	A	G	1: 92,861,274		probably benign	Het
Apmap	T	C	2: 150,600,332	T41A	probably benign	Het
Cacna1a	A	G	8: 84,614,721	Y1804C	probably damaging	Het
Cacna1e	A	T	1: 154,561,791	I333N	possibly damaging	Het
Cdsn	C	A	17: 35,555,034	S153R	unknown	Het
Celsr1	A	T	15: 85,932,411	M1777K	probably benign	Het
Cmtr1	A	G	17: 29,682,165	M249V	probably benign	Het
Cmya5	A	G	13: 93,095,166	L1138P	probably damaging	Het
Dmap1	T	A	4: 117,675,535		probably null	Het
Dnah17	T	C	11: 118,119,571	Y307C	probably benign	Het
Dnah5	T	A	15: 28,270,420	L956H	probably damaging	Het
Enpp3	C	T	10: 24,787,852	S537N	probably damaging	Het
Eya3	T	A	4: 132,711,862	L323Q	probably damaging	Het
Fads3	A	T	19: 10,054,267	H226L	probably damaging	Het
Flrt3	T	A	2: 140,660,445	D421V	possibly damaging	Het
Frmd4a	T	C	2: 4,602,249	V370A	possibly damaging	Het
Gapvd1	T	C	2: 34,690,459		probably null	Het
Gm2178	T	C	14: 26,514,840		probably benign	Het
Gm5592	A	G	7: 41,288,464	N390S	probably benign	Het
Hoxa10	T	A	6: 52,234,820	R39*	probably null	Het
Kcnj1	A	G	9: 32,397,182	T281A	probably damaging	Het
Myo10	T	C	15: 25,805,659	Y1709H	probably benign	Het
Nacad	T	C	11: 6,599,810	D1127G	probably benign	Het
Naip1	T	A	13: 100,444,737	M1L	probably damaging	Het
Olfr1331	A	T	4: 118,869,144	Y121F	probably benign	Het
Olfr811	G	A	10: 129,801,820	A235V	probably damaging	Het
Olfr811	C	A	10: 129,801,821	A235S	probably damaging	Het
Pcdhb12	G	A	18: 37,435,642		probably benign	Het
Pde1b	T	C	15: 103,521,482	V134A	probably damaging	Het
Plxnb2	A	T	15: 89,158,000	D1600E	probably benign	Het
Prss54	T	A	8: 95,565,458		probably null	Het
Ryr3	A	T	2: 112,635,396	I4757N	probably damaging	Het
Slc1a6	T	C	10: 78,788,988	Y76H	possibly damaging	Het
Slco3a1	C	T	7: 74,318,506	D489N	probably benign	Het
Sox15	G	T	11: 69,655,890	G173V	possibly damaging	Het
Stard3	T	C	11: 98,372,262	S48P	probably damaging	Het
Stk32c	G	A	7: 139,122,923	Q67*	probably null	Het
Svil	T	A	18: 5,116,016	W2101R	probably damaging	Het
Taar7e	T	A	10: 24,038,529	Y306N	probably damaging	Het
Tarbp1	T	A	8: 126,427,541	M1485L	probably benign	Het
Togaram1	A	G	12: 64,967,487	D504G	probably damaging	Het
Trrap	T	C	5: 144,802,961	L1091S	possibly damaging	Het
Unc80	A	G	1: 66,675,067	E2856G	possibly damaging	Het
Usp47	C	T	7: 112,087,932	T699M	probably damaging	Het

Other mutations in Crim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00815:Crim1	APN	17	78370091	missense	probably damaging	1.00
IGL01090:Crim1	APN	17	78347229	missense	probably damaging	0.97
IGL01490:Crim1	APN	17	78335296	missense	possibly damaging	0.94
IGL01686:Crim1	APN	17	78344434	missense	probably benign	0.09
IGL01769:Crim1	APN	17	78313235	missense	probably benign	0.02
IGL02004:Crim1	APN	17	78372575	splice site	probably benign
IGL02211:Crim1	APN	17	78355145	missense	probably damaging	1.00
IGL02275:Crim1	APN	17	78369998	missense	possibly damaging	0.56
IGL02408:Crim1	APN	17	78315654	missense	possibly damaging	0.78
IGL02411:Crim1	APN	17	78335334	nonsense	probably null
IGL02453:Crim1	APN	17	78344484	missense	probably damaging	1.00
IGL02481:Crim1	APN	17	78350798	missense	probably damaging	0.98
IGL02632:Crim1	APN	17	78372674	missense	probably benign	0.08
IGL02652:Crim1	APN	17	78315677	missense	probably damaging	1.00
IGL02696:Crim1	APN	17	78279973	missense	probably damaging	0.96
IGL02811:Crim1	APN	17	78350701	missense	possibly damaging	0.62
IGL03105:Crim1	APN	17	78315750	splice site	probably benign
IGL03349:Crim1	APN	17	78355150	nonsense	probably null
bugeye	UTSW	17	78281347	missense	possibly damaging	0.94
IGL03097:Crim1	UTSW	17	78367798	missense	probably benign	0.00
R0227:Crim1	UTSW	17	78344509	splice site	probably benign
R0458:Crim1	UTSW	17	78313226	missense	probably damaging	0.98
R0482:Crim1	UTSW	17	78372579	missense	probably benign	0.00
R0989:Crim1	UTSW	17	78200944	missense	probably benign	0.21
R1266:Crim1	UTSW	17	78200833	small deletion	probably benign
R1529:Crim1	UTSW	17	78367954	missense	probably benign
R1679:Crim1	UTSW	17	78200799	missense	probably benign	0.27
R1909:Crim1	UTSW	17	78313127	missense	probably benign	0.26
R2273:Crim1	UTSW	17	78355179	critical splice donor site	probably null
R3899:Crim1	UTSW	17	78281354	missense	probably benign	0.00
R3909:Crim1	UTSW	17	78281239	splice site	probably benign
R4092:Crim1	UTSW	17	78350836	missense	probably damaging	1.00
R4154:Crim1	UTSW	17	78237843	missense	probably benign	0.01
R4687:Crim1	UTSW	17	78303025	missense	probably damaging	1.00
R5022:Crim1	UTSW	17	78280129	missense	possibly damaging	0.95
R5073:Crim1	UTSW	17	78281347	missense	possibly damaging	0.94
R5089:Crim1	UTSW	17	78374090	missense	probably damaging	1.00
R5284:Crim1	UTSW	17	78313266	missense	possibly damaging	0.83
R5461:Crim1	UTSW	17	78237807	missense	probably damaging	1.00
R5635:Crim1	UTSW	17	78315641	missense	probably damaging	1.00
R5686:Crim1	UTSW	17	78374083	missense	possibly damaging	0.63
R5956:Crim1	UTSW	17	78315717	missense	probably damaging	1.00
R6129:Crim1	UTSW	17	78281309	missense	probably benign	0.17
R6265:Crim1	UTSW	17	78370085	missense	probably benign	0.01
R6812:Crim1	UTSW	17	78315600	missense	probably damaging	1.00
R6858:Crim1	UTSW	17	78315627	missense	probably damaging	1.00
R7920:Crim1	UTSW	17	78303064	missense	probably damaging	1.00
R8022:Crim1	UTSW	17	78315555	missense	possibly damaging	0.82
R8434:Crim1	UTSW	17	78347257	missense	probably benign	0.00
X0064:Crim1	UTSW	17	78200833	small deletion	probably benign
Z1088:Crim1	UTSW	17	78367835	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- CGTAGAGTAGGTACTTGCCAC -3'
(R):5'- TGTCTGAGGTTCCCTGTGAC -3'

Sequencing Primer
(F):5'- AGAGTAGGTACTTGCCACTTTGTTTG -3'
(R):5'- CTGAGGTTCCCTGTGACAATATGAC -3'

Posted On

2017-08-16