Incidental Mutation 'R6117:Fads3'
ID485190
Institutional Source Beutler Lab
Gene Symbol Fads3
Ensembl Gene ENSMUSG00000024664
Gene Namefatty acid desaturase 3
Synonyms
MMRRC Submission 044266-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6117 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location10041548-10059671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10054267 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 226 (H226L)
Ref Sequence ENSEMBL: ENSMUSP00000111659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115995]
Predicted Effect probably damaging
Transcript: ENSMUST00000115995
AA Change: H226L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111659
Gene: ENSMUSG00000024664
AA Change: H226L

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Cyt-b5 27 101 6.21e-16 SMART
Pfam:FA_desaturase 162 423 4.1e-35 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members FADS1 and FADS2 at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout affects highly unsaturated fatty acid levels in the liver and brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A G 7: 76,698,786 Y625C probably damaging Het
Ankmy1 A G 1: 92,861,274 probably benign Het
Apmap T C 2: 150,600,332 T41A probably benign Het
Cacna1a A G 8: 84,614,721 Y1804C probably damaging Het
Cacna1e A T 1: 154,561,791 I333N possibly damaging Het
Cdsn C A 17: 35,555,034 S153R unknown Het
Celsr1 A T 15: 85,932,411 M1777K probably benign Het
Cmtr1 A G 17: 29,682,165 M249V probably benign Het
Cmya5 A G 13: 93,095,166 L1138P probably damaging Het
Crim1 A C 17: 78,303,088 D324A probably damaging Het
Dmap1 T A 4: 117,675,535 probably null Het
Dnah17 T C 11: 118,119,571 Y307C probably benign Het
Dnah5 T A 15: 28,270,420 L956H probably damaging Het
Enpp3 C T 10: 24,787,852 S537N probably damaging Het
Eya3 T A 4: 132,711,862 L323Q probably damaging Het
Flrt3 T A 2: 140,660,445 D421V possibly damaging Het
Frmd4a T C 2: 4,602,249 V370A possibly damaging Het
Gapvd1 T C 2: 34,690,459 probably null Het
Gm2178 T C 14: 26,514,840 probably benign Het
Gm5592 A G 7: 41,288,464 N390S probably benign Het
Hoxa10 T A 6: 52,234,820 R39* probably null Het
Kcnj1 A G 9: 32,397,182 T281A probably damaging Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Naip1 T A 13: 100,444,737 M1L probably damaging Het
Olfr1331 A T 4: 118,869,144 Y121F probably benign Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Pcdhb12 G A 18: 37,435,642 probably benign Het
Pde1b T C 15: 103,521,482 V134A probably damaging Het
Plxnb2 A T 15: 89,158,000 D1600E probably benign Het
Prss54 T A 8: 95,565,458 probably null Het
Ryr3 A T 2: 112,635,396 I4757N probably damaging Het
Slc1a6 T C 10: 78,788,988 Y76H possibly damaging Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Sox15 G T 11: 69,655,890 G173V possibly damaging Het
Stard3 T C 11: 98,372,262 S48P probably damaging Het
Stk32c G A 7: 139,122,923 Q67* probably null Het
Svil T A 18: 5,116,016 W2101R probably damaging Het
Taar7e T A 10: 24,038,529 Y306N probably damaging Het
Tarbp1 T A 8: 126,427,541 M1485L probably benign Het
Togaram1 A G 12: 64,967,487 D504G probably damaging Het
Trrap T C 5: 144,802,961 L1091S possibly damaging Het
Unc80 A G 1: 66,675,067 E2856G possibly damaging Het
Usp47 C T 7: 112,087,932 T699M probably damaging Het
Other mutations in Fads3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fads3 APN 19 10052299 missense probably null 0.98
IGL00422:Fads3 APN 19 10055681 missense possibly damaging 0.80
IGL01081:Fads3 APN 19 10053002 missense probably benign 0.00
IGL02454:Fads3 APN 19 10055119 missense probably damaging 0.97
IGL02477:Fads3 APN 19 10056442 missense probably damaging 1.00
R0611:Fads3 UTSW 19 10041836 missense probably damaging 1.00
R1169:Fads3 UTSW 19 10054099 missense possibly damaging 0.82
R1400:Fads3 UTSW 19 10056300 splice site probably null
R1893:Fads3 UTSW 19 10056504 missense probably benign
R2508:Fads3 UTSW 19 10056454 missense probably damaging 1.00
R3151:Fads3 UTSW 19 10057898 missense probably benign 0.01
R4543:Fads3 UTSW 19 10041811 missense possibly damaging 0.60
R4766:Fads3 UTSW 19 10056020 missense possibly damaging 0.94
R4823:Fads3 UTSW 19 10041888 missense probably damaging 0.98
R5117:Fads3 UTSW 19 10041958 critical splice donor site probably null
R5846:Fads3 UTSW 19 10053033 missense probably null 1.00
R6225:Fads3 UTSW 19 10041838 missense probably benign 0.25
X0027:Fads3 UTSW 19 10054250 missense probably damaging 1.00
Z1176:Fads3 UTSW 19 10041807 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GTGCTGGTGTCTGCAACATG -3'
(R):5'- GGCAACTCTAGATTCTAGCCCC -3'

Sequencing Primer
(F):5'- GTCTGCAACATGATCTAGGTCATGC -3'
(R):5'- AGATTCTAGCCCCTGAGCC -3'
Posted On2017-08-16