Incidental Mutation 'R6118:Olfr1082'
ID485195
Institutional Source Beutler Lab
Gene Symbol Olfr1082
Ensembl Gene ENSMUSG00000111689
Gene Nameolfactory receptor 1082
SynonymsGA_x6K02T2Q125-48079993-48079157, MOR192-4_p
MMRRC Submission 044267-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R6118 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location86593412-86598966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86594414 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 138 (H138L)
Ref Sequence ENSEMBL: ENSMUSP00000150706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000215600]
Predicted Effect probably benign
Transcript: ENSMUST00000111578
AA Change: H138L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107204
Gene: ENSMUSG00000079239
AA Change: H138L

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 5.6e-31 PFAM
Pfam:7tm_4 139 283 4.5e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215600
AA Change: H138L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,431,291 K316N probably damaging Het
Als2 A T 1: 59,203,069 V609E possibly damaging Het
Ank3 A G 10: 69,994,401 I71V probably damaging Het
Antxr2 T A 5: 97,949,201 D351V probably damaging Het
Arel1 A G 12: 84,941,939 V12A possibly damaging Het
Atad1 C T 19: 32,687,297 R239H possibly damaging Het
B3galnt2 A G 13: 13,991,509 T330A probably damaging Het
Bag6 T A 17: 35,143,624 I636N probably damaging Het
C1qtnf6 T C 15: 78,525,395 D84G probably damaging Het
Ceacam20 T C 7: 19,971,729 V215A possibly damaging Het
Chtf18 C T 17: 25,719,159 D967N probably damaging Het
Cntnap2 T A 6: 47,193,077 I1159K possibly damaging Het
Col2a1 T C 15: 97,998,567 D67G unknown Het
Csde1 T A 3: 103,054,754 V627E probably benign Het
Epb41l1 G A 2: 156,522,477 E969K probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gabbr2 C T 4: 46,736,459 R474Q probably damaging Het
Hap1 G T 11: 100,355,794 T95N probably benign Het
Hist2h2bb T A 3: 96,269,951 V67E probably damaging Het
Jmjd1c A G 10: 67,240,012 K1886R probably damaging Het
Kndc1 A G 7: 139,923,802 D1007G probably damaging Het
Mcm2 C T 6: 88,887,836 A553T probably damaging Het
Memo1 T C 17: 74,202,307 Y239C possibly damaging Het
Meox2 GCACCACCACCACCACCACCA GCACCACCACCACCACCA 12: 37,109,031 probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Obsl1 A G 1: 75,492,078 probably benign Het
Olfr1212 T A 2: 88,959,118 Y217* probably null Het
Pold3 A G 7: 100,096,407 S180P possibly damaging Het
Rbm12b2 T C 4: 12,095,135 S665P probably benign Het
Rfc4 A T 16: 23,120,943 S86T probably damaging Het
Rfx6 T A 10: 51,711,866 N277K possibly damaging Het
Ryr2 C A 13: 11,792,689 V865F possibly damaging Het
Skint4 T A 4: 112,119,822 probably null Het
Slc38a10 T C 11: 120,132,843 Y249C probably damaging Het
Slco1b2 A G 6: 141,657,510 T206A probably benign Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Tbc1d1 C T 5: 64,284,037 L655F probably damaging Het
Tpp2 A T 1: 43,940,146 I68F probably damaging Het
Trim30c G T 7: 104,382,081 T509K probably benign Het
Zfp827 G T 8: 79,076,438 K546N possibly damaging Het
Other mutations in Olfr1082
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0483:Olfr1082 UTSW 2 86594408 missense probably benign 0.07
R0675:Olfr1082 UTSW 2 86594079 missense probably benign 0.00
R0718:Olfr1082 UTSW 2 86594081 missense probably benign 0.01
R0727:Olfr1082 UTSW 2 86594380 nonsense probably null
R1517:Olfr1082 UTSW 2 86594604 missense probably damaging 0.99
R1850:Olfr1082 UTSW 2 86594104 nonsense probably null
R2430:Olfr1082 UTSW 2 86594708 missense probably benign 0.00
R2474:Olfr1082 UTSW 2 86594613 missense probably benign 0.00
R3009:Olfr1082 UTSW 2 86594370 missense probably benign 0.07
R3122:Olfr1082 UTSW 2 86594610 missense possibly damaging 0.91
R4006:Olfr1082 UTSW 2 86594564 missense probably benign 0.14
R4007:Olfr1082 UTSW 2 86594564 missense probably benign 0.14
R4581:Olfr1082 UTSW 2 86594228 missense probably benign 0.08
R4762:Olfr1082 UTSW 2 86594037 missense possibly damaging 0.60
R5617:Olfr1082 UTSW 2 86594001 missense probably benign 0.07
R6140:Olfr1082 UTSW 2 86594104 nonsense probably null
R6313:Olfr1082 UTSW 2 86594067 missense possibly damaging 0.76
R6528:Olfr1082 UTSW 2 86594465 missense probably damaging 1.00
R6785:Olfr1082 UTSW 2 86594421 missense probably damaging 0.98
R6792:Olfr1082 UTSW 2 86593939 missense probably benign 0.09
R6857:Olfr1082 UTSW 2 86594264 missense probably damaging 1.00
R6998:Olfr1082 UTSW 2 86594144 missense probably damaging 1.00
R7241:Olfr1082 UTSW 2 86594154 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCTCAGCAGAGTTCATCCTGAG -3'
(R):5'- TATTCGACAACTGTGGGACC -3'

Sequencing Primer
(F):5'- CAGAGTTCATCCTGAGAACAGCTATG -3'
(R):5'- TTCGACAACTGTGGGACCAAAAATG -3'
Posted On2017-08-16