Mutagenetix > Incidental Mutations

Incidental Mutation 'R6118:Epb41l1'

485197

Institutional Source

Beutler Lab

Gene Symbol

Epb41l1

Ensembl Gene

ENSMUSG00000027624

Gene Name

erythrocyte membrane protein band 4.1 like 1

Synonyms

Epb4.1l1, 4.1N

MMRRC Submission

044267-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6118 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

156420909-156543214 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 156522477 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 969 (E969K)

Ref Sequence

ENSEMBL: ENSMUSP00000121161 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029155] [ENSMUST00000103135] [ENSMUST00000103136] [ENSMUST00000103137] [ENSMUST00000109572] [ENSMUST00000109574] [ENSMUST00000109577] [ENSMUST00000125153]

Predicted Effect

probably benign
Transcript: ENSMUST00000029155

SMART Domains

Protein: ENSMUSP00000029155
Gene: ENSMUSG00000027624

Domain	Start	End	E-Value	Type
low complexity region	14	35	N/A	INTRINSIC
B41	93	288	6.19e-78	SMART
FERM_C	292	382	2.47e-39	SMART
FA	384	430	1.9e-17	SMART
low complexity region	459	472	N/A	INTRINSIC
Pfam:SAB	493	544	8.4e-25	PFAM
low complexity region	606	615	N/A	INTRINSIC
Pfam:4_1_CTD	770	867	5.9e-46	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000103135

SMART Domains

Protein: ENSMUSP00000099424
Gene: ENSMUSG00000027624

Domain	Start	End	E-Value	Type
low complexity region	14	35	N/A	INTRINSIC
B41	93	288	6.19e-78	SMART
FERM_C	292	382	2.47e-39	SMART
FA	384	430	1.9e-17	SMART
low complexity region	459	472	N/A	INTRINSIC
Pfam:SAB	493	544	5.9e-25	PFAM
low complexity region	606	615	N/A	INTRINSIC
Pfam:4_1_CTD	740	866	1.6e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000103136

SMART Domains

Protein: ENSMUSP00000099425
Gene: ENSMUSG00000027624

Domain	Start	End	E-Value	Type
low complexity region	14	35	N/A	INTRINSIC
B41	93	288	6.19e-78	SMART
FERM_C	292	382	2.47e-39	SMART
FA	384	430	1.9e-17	SMART
low complexity region	459	472	N/A	INTRINSIC
Pfam:SAB	493	544	8.4e-25	PFAM
low complexity region	606	615	N/A	INTRINSIC
Pfam:4_1_CTD	770	867	5.9e-46	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000103137

SMART Domains

Protein: ENSMUSP00000099426
Gene: ENSMUSG00000027624

Domain	Start	End	E-Value	Type
low complexity region	14	35	N/A	INTRINSIC
B41	93	288	6.19e-78	SMART
FERM_C	292	382	2.47e-39	SMART
FA	384	430	1.9e-17	SMART
low complexity region	459	472	N/A	INTRINSIC
Pfam:SAB	493	544	5.9e-25	PFAM
low complexity region	606	615	N/A	INTRINSIC
Pfam:4_1_CTD	740	866	1.6e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109572

SMART Domains

Protein: ENSMUSP00000105200
Gene: ENSMUSG00000027624

Domain	Start	End	E-Value	Type
low complexity region	14	35	N/A	INTRINSIC
B41	93	215	5.6e-12	SMART
FERM_C	219	309	1.2e-43	SMART
FA	311	357	9e-22	SMART
low complexity region	386	399	N/A	INTRINSIC
Pfam:SAB	408	459	2.2e-21	PFAM
Pfam:4_1_CTD	514	619	1.3e-43	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109574

SMART Domains

Protein: ENSMUSP00000105202
Gene: ENSMUSG00000027624

Domain	Start	End	E-Value	Type
low complexity region	14	35	N/A	INTRINSIC
B41	93	288	6.19e-78	SMART
FERM_C	292	382	2.47e-39	SMART
FA	384	430	1.9e-17	SMART
low complexity region	458	471	N/A	INTRINSIC
Pfam:SAB	480	531	4.8e-24	PFAM
Pfam:4_1_CTD	610	718	4.9e-46	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109577

SMART Domains

Protein: ENSMUSP00000105205
Gene: ENSMUSG00000027624

Domain	Start	End	E-Value	Type
low complexity region	14	35	N/A	INTRINSIC
B41	93	288	6.19e-78	SMART
FERM_C	292	382	2.47e-39	SMART
FA	384	430	1.9e-17	SMART
low complexity region	459	472	N/A	INTRINSIC
Pfam:SAB	481	532	5.9e-24	PFAM
low complexity region	594	603	N/A	INTRINSIC
Pfam:4_1_CTD	758	855	5.8e-46	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125153
AA Change: E969K

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000121161
Gene: ENSMUSG00000027624
AA Change: E969K

Domain	Start	End	E-Value	Type
low complexity region	14	35	N/A	INTRINSIC
B41	93	288	6.19e-78	SMART
FERM_C	292	382	2.47e-39	SMART
FA	384	430	1.9e-17	SMART
low complexity region	458	471	N/A	INTRINSIC
Pfam:SAB	492	543	7.4e-25	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Erythrocyte membrane protein band 4.1 (EPB41) is a multifunctional protein that mediates interactions between the erythrocyte cytoskeleton and the overlying plasma membrane. The encoded protein binds and stabilizes D2 and D3 dopamine receptors at the neuronal plasma membrane. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit no obvious phenotypic abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	T	G	10: 10,431,291	K316N	probably damaging	Het
Als2	A	T	1: 59,203,069	V609E	possibly damaging	Het
Ank3	A	G	10: 69,994,401	I71V	probably damaging	Het
Antxr2	T	A	5: 97,949,201	D351V	probably damaging	Het
Arel1	A	G	12: 84,941,939	V12A	possibly damaging	Het
Atad1	C	T	19: 32,687,297	R239H	possibly damaging	Het
B3galnt2	A	G	13: 13,991,509	T330A	probably damaging	Het
Bag6	T	A	17: 35,143,624	I636N	probably damaging	Het
C1qtnf6	T	C	15: 78,525,395	D84G	probably damaging	Het
Ceacam20	T	C	7: 19,971,729	V215A	possibly damaging	Het
Chtf18	C	T	17: 25,719,159	D967N	probably damaging	Het
Cntnap2	T	A	6: 47,193,077	I1159K	possibly damaging	Het
Col2a1	T	C	15: 97,998,567	D67G	unknown	Het
Csde1	T	A	3: 103,054,754	V627E	probably benign	Het
Fam208b	C	T	13: 3,581,891	R870H	possibly damaging	Het
Fam53c	A	C	18: 34,768,690	E220A	probably damaging	Het
Gabbr2	C	T	4: 46,736,459	R474Q	probably damaging	Het
Hap1	G	T	11: 100,355,794	T95N	probably benign	Het
Hist2h2bb	T	A	3: 96,269,951	V67E	probably damaging	Het
Jmjd1c	A	G	10: 67,240,012	K1886R	probably damaging	Het
Kndc1	A	G	7: 139,923,802	D1007G	probably damaging	Het
Mcm2	C	T	6: 88,887,836	A553T	probably damaging	Het
Memo1	T	C	17: 74,202,307	Y239C	possibly damaging	Het
Meox2	GCACCACCACCACCACCACCA	GCACCACCACCACCACCA	12: 37,109,031		probably benign	Het
Mptx2	G	A	1: 173,274,847	L92F	probably benign	Het
Obsl1	A	G	1: 75,492,078		probably benign	Het
Olfr1082	T	A	2: 86,594,414	H138L	probably benign	Het
Olfr1212	T	A	2: 88,959,118	Y217*	probably null	Het
Pold3	A	G	7: 100,096,407	S180P	possibly damaging	Het
Rbm12b2	T	C	4: 12,095,135	S665P	probably benign	Het
Rfc4	A	T	16: 23,120,943	S86T	probably damaging	Het
Rfx6	T	A	10: 51,711,866	N277K	possibly damaging	Het
Ryr2	C	A	13: 11,792,689	V865F	possibly damaging	Het
Skint4	T	A	4: 112,119,822		probably null	Het
Slc38a10	T	C	11: 120,132,843	Y249C	probably damaging	Het
Slco1b2	A	G	6: 141,657,510	T206A	probably benign	Het
Slco3a1	C	T	7: 74,318,506	D489N	probably benign	Het
Tbc1d1	C	T	5: 64,284,037	L655F	probably damaging	Het
Tpp2	A	T	1: 43,940,146	I68F	probably damaging	Het
Trim30c	G	T	7: 104,382,081	T509K	probably benign	Het
Zfp827	G	T	8: 79,076,438	K546N	possibly damaging	Het

Other mutations in Epb41l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00792:Epb41l1	APN	2	156525019	missense	probably damaging	1.00
IGL00852:Epb41l1	APN	2	156503718	missense	probably damaging	1.00
IGL02148:Epb41l1	APN	2	156511828	intron	probably benign
IGL02164:Epb41l1	APN	2	156494949	splice site	probably benign
IGL02515:Epb41l1	APN	2	156537013	missense	probably damaging	1.00
R0787:Epb41l1	UTSW	2	156494090	missense	probably damaging	0.98
R1450:Epb41l1	UTSW	2	156511825	intron	probably benign
R1566:Epb41l1	UTSW	2	156521959	missense	probably benign	0.06
R1759:Epb41l1	UTSW	2	156521974	missense	probably benign	0.06
R1812:Epb41l1	UTSW	2	156496511	missense	probably damaging	1.00
R1908:Epb41l1	UTSW	2	156510817	missense	possibly damaging	0.80
R2152:Epb41l1	UTSW	2	156514128	missense	probably damaging	1.00
R3023:Epb41l1	UTSW	2	156514209	missense	probably damaging	0.99
R4178:Epb41l1	UTSW	2	156521557	missense	probably benign
R4491:Epb41l1	UTSW	2	156522168	missense	probably benign	0.00
R4610:Epb41l1	UTSW	2	156509261	missense	possibly damaging	0.71
R4770:Epb41l1	UTSW	2	156529424	missense	probably benign	0.00
R5038:Epb41l1	UTSW	2	156521410	missense	probably benign	0.12
R5049:Epb41l1	UTSW	2	156524939	missense	possibly damaging	0.95
R5129:Epb41l1	UTSW	2	156509281	missense	possibly damaging	0.80
R5624:Epb41l1	UTSW	2	156533771	splice site	probably benign
R5780:Epb41l1	UTSW	2	156496525	missense	probably damaging	1.00
R5810:Epb41l1	UTSW	2	156499655	missense	probably damaging	1.00
R5952:Epb41l1	UTSW	2	156503788	missense	probably damaging	1.00
R5952:Epb41l1	UTSW	2	156524983	missense	probably benign
R5961:Epb41l1	UTSW	2	156521786	missense	probably benign	0.25
R6496:Epb41l1	UTSW	2	156533796	missense	possibly damaging	0.92
R6861:Epb41l1	UTSW	2	156525222	missense	probably benign
R6959:Epb41l1	UTSW	2	156499587	missense	probably benign	0.03
R7009:Epb41l1	UTSW	2	156534683	splice site	probably null
R7036:Epb41l1	UTSW	2	156529402	missense	probably benign
R7046:Epb41l1	UTSW	2	156526892	missense	possibly damaging	0.56
R7263:Epb41l1	UTSW	2	156495123	critical splice donor site	probably null
R7322:Epb41l1	UTSW	2	156503851	missense	probably damaging	0.98
R7398:Epb41l1	UTSW	2	156534762	missense	probably damaging	1.00
R7914:Epb41l1	UTSW	2	156522208	missense	probably benign	0.03
R8039:Epb41l1	UTSW	2	156506412	missense	probably damaging	0.99
R8357:Epb41l1	UTSW	2	156525251	missense	probably benign	0.16
R8415:Epb41l1	UTSW	2	156526953	missense	probably benign	0.00
R8457:Epb41l1	UTSW	2	156525251	missense	probably benign	0.16
R8458:Epb41l1	UTSW	2	156521764	missense	probably benign	0.00
R8475:Epb41l1	UTSW	2	156522230	missense	probably damaging	0.98
X0065:Epb41l1	UTSW	2	156509277	missense	probably damaging	1.00
Z1177:Epb41l1	UTSW	2	156508827	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AAAAGTCCTCCGGCAAGATGG -3'
(R):5'- CTGGACTCTCTTCAGGGAGATG -3'

Sequencing Primer
(F):5'- TGGAAGAAGAACCCTCCTGG -3'
(R):5'- GACTCTCTTCAGGGAGATGGATATAC -3'

Posted On

2017-08-16