Incidental Mutation 'R6118:Epb41l1'
ID485197
Institutional Source Beutler Lab
Gene Symbol Epb41l1
Ensembl Gene ENSMUSG00000027624
Gene Nameerythrocyte membrane protein band 4.1 like 1
SynonymsEpb4.1l1, 4.1N
MMRRC Submission 044267-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6118 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location156420909-156543214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 156522477 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 969 (E969K)
Ref Sequence ENSEMBL: ENSMUSP00000121161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029155] [ENSMUST00000103135] [ENSMUST00000103136] [ENSMUST00000103137] [ENSMUST00000109572] [ENSMUST00000109574] [ENSMUST00000109577] [ENSMUST00000125153]
Predicted Effect probably benign
Transcript: ENSMUST00000029155
SMART Domains Protein: ENSMUSP00000029155
Gene: ENSMUSG00000027624

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 8.4e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 770 867 5.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103135
SMART Domains Protein: ENSMUSP00000099424
Gene: ENSMUSG00000027624

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 5.9e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 740 866 1.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103136
SMART Domains Protein: ENSMUSP00000099425
Gene: ENSMUSG00000027624

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 8.4e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 770 867 5.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103137
SMART Domains Protein: ENSMUSP00000099426
Gene: ENSMUSG00000027624

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 5.9e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 740 866 1.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109572
SMART Domains Protein: ENSMUSP00000105200
Gene: ENSMUSG00000027624

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 215 5.6e-12 SMART
FERM_C 219 309 1.2e-43 SMART
FA 311 357 9e-22 SMART
low complexity region 386 399 N/A INTRINSIC
Pfam:SAB 408 459 2.2e-21 PFAM
Pfam:4_1_CTD 514 619 1.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109574
SMART Domains Protein: ENSMUSP00000105202
Gene: ENSMUSG00000027624

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 458 471 N/A INTRINSIC
Pfam:SAB 480 531 4.8e-24 PFAM
Pfam:4_1_CTD 610 718 4.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109577
SMART Domains Protein: ENSMUSP00000105205
Gene: ENSMUSG00000027624

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 481 532 5.9e-24 PFAM
low complexity region 594 603 N/A INTRINSIC
Pfam:4_1_CTD 758 855 5.8e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125153
AA Change: E969K

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121161
Gene: ENSMUSG00000027624
AA Change: E969K

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 458 471 N/A INTRINSIC
Pfam:SAB 492 543 7.4e-25 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Erythrocyte membrane protein band 4.1 (EPB41) is a multifunctional protein that mediates interactions between the erythrocyte cytoskeleton and the overlying plasma membrane. The encoded protein binds and stabilizes D2 and D3 dopamine receptors at the neuronal plasma membrane. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit no obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,431,291 K316N probably damaging Het
Als2 A T 1: 59,203,069 V609E possibly damaging Het
Ank3 A G 10: 69,994,401 I71V probably damaging Het
Antxr2 T A 5: 97,949,201 D351V probably damaging Het
Arel1 A G 12: 84,941,939 V12A possibly damaging Het
Atad1 C T 19: 32,687,297 R239H possibly damaging Het
B3galnt2 A G 13: 13,991,509 T330A probably damaging Het
Bag6 T A 17: 35,143,624 I636N probably damaging Het
C1qtnf6 T C 15: 78,525,395 D84G probably damaging Het
Ceacam20 T C 7: 19,971,729 V215A possibly damaging Het
Chtf18 C T 17: 25,719,159 D967N probably damaging Het
Cntnap2 T A 6: 47,193,077 I1159K possibly damaging Het
Col2a1 T C 15: 97,998,567 D67G unknown Het
Csde1 T A 3: 103,054,754 V627E probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gabbr2 C T 4: 46,736,459 R474Q probably damaging Het
Hap1 G T 11: 100,355,794 T95N probably benign Het
Hist2h2bb T A 3: 96,269,951 V67E probably damaging Het
Jmjd1c A G 10: 67,240,012 K1886R probably damaging Het
Kndc1 A G 7: 139,923,802 D1007G probably damaging Het
Mcm2 C T 6: 88,887,836 A553T probably damaging Het
Memo1 T C 17: 74,202,307 Y239C possibly damaging Het
Meox2 GCACCACCACCACCACCACCA GCACCACCACCACCACCA 12: 37,109,031 probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Obsl1 A G 1: 75,492,078 probably benign Het
Olfr1082 T A 2: 86,594,414 H138L probably benign Het
Olfr1212 T A 2: 88,959,118 Y217* probably null Het
Pold3 A G 7: 100,096,407 S180P possibly damaging Het
Rbm12b2 T C 4: 12,095,135 S665P probably benign Het
Rfc4 A T 16: 23,120,943 S86T probably damaging Het
Rfx6 T A 10: 51,711,866 N277K possibly damaging Het
Ryr2 C A 13: 11,792,689 V865F possibly damaging Het
Skint4 T A 4: 112,119,822 probably null Het
Slc38a10 T C 11: 120,132,843 Y249C probably damaging Het
Slco1b2 A G 6: 141,657,510 T206A probably benign Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Tbc1d1 C T 5: 64,284,037 L655F probably damaging Het
Tpp2 A T 1: 43,940,146 I68F probably damaging Het
Trim30c G T 7: 104,382,081 T509K probably benign Het
Zfp827 G T 8: 79,076,438 K546N possibly damaging Het
Other mutations in Epb41l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Epb41l1 APN 2 156525019 missense probably damaging 1.00
IGL00852:Epb41l1 APN 2 156503718 missense probably damaging 1.00
IGL02148:Epb41l1 APN 2 156511828 intron probably benign
IGL02164:Epb41l1 APN 2 156494949 splice site probably benign
IGL02515:Epb41l1 APN 2 156537013 missense probably damaging 1.00
R0787:Epb41l1 UTSW 2 156494090 missense probably damaging 0.98
R1450:Epb41l1 UTSW 2 156511825 intron probably benign
R1566:Epb41l1 UTSW 2 156521959 missense probably benign 0.06
R1759:Epb41l1 UTSW 2 156521974 missense probably benign 0.06
R1812:Epb41l1 UTSW 2 156496511 missense probably damaging 1.00
R1908:Epb41l1 UTSW 2 156510817 missense possibly damaging 0.80
R2152:Epb41l1 UTSW 2 156514128 missense probably damaging 1.00
R3023:Epb41l1 UTSW 2 156514209 missense probably damaging 0.99
R4178:Epb41l1 UTSW 2 156521557 missense probably benign
R4491:Epb41l1 UTSW 2 156522168 missense probably benign 0.00
R4610:Epb41l1 UTSW 2 156509261 missense possibly damaging 0.71
R4770:Epb41l1 UTSW 2 156529424 missense probably benign 0.00
R5038:Epb41l1 UTSW 2 156521410 missense probably benign 0.12
R5049:Epb41l1 UTSW 2 156524939 missense possibly damaging 0.95
R5129:Epb41l1 UTSW 2 156509281 missense possibly damaging 0.80
R5624:Epb41l1 UTSW 2 156533771 splice site probably benign
R5780:Epb41l1 UTSW 2 156496525 missense probably damaging 1.00
R5810:Epb41l1 UTSW 2 156499655 missense probably damaging 1.00
R5952:Epb41l1 UTSW 2 156503788 missense probably damaging 1.00
R5952:Epb41l1 UTSW 2 156524983 missense probably benign
R5961:Epb41l1 UTSW 2 156521786 missense probably benign 0.25
R6496:Epb41l1 UTSW 2 156533796 missense possibly damaging 0.92
R6861:Epb41l1 UTSW 2 156525222 missense probably benign
R6959:Epb41l1 UTSW 2 156499587 missense probably benign 0.03
R7009:Epb41l1 UTSW 2 156534683 splice site probably null
R7036:Epb41l1 UTSW 2 156529402 missense probably benign
R7046:Epb41l1 UTSW 2 156526892 missense possibly damaging 0.56
R7263:Epb41l1 UTSW 2 156495123 critical splice donor site probably null
R7322:Epb41l1 UTSW 2 156503851 missense probably damaging 0.98
R7398:Epb41l1 UTSW 2 156534762 missense probably damaging 1.00
X0065:Epb41l1 UTSW 2 156509277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAAGTCCTCCGGCAAGATGG -3'
(R):5'- CTGGACTCTCTTCAGGGAGATG -3'

Sequencing Primer
(F):5'- TGGAAGAAGAACCCTCCTGG -3'
(R):5'- GACTCTCTTCAGGGAGATGGATATAC -3'
Posted On2017-08-16