Incidental Mutation 'R6118:Hist2h2bb'
ID485198
Institutional Source Beutler Lab
Gene Symbol Hist2h2bb
Ensembl Gene ENSMUSG00000105827
Gene Namehistone cluster 2, H2bb
SynonymsH2b-616
MMRRC Submission 044267-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R6118 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location96269752-96270132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96269951 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 67 (V67E)
Ref Sequence ENSEMBL: ENSMUSP00000135427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098843] [ENSMUST00000177113]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000051089
SMART Domains Protein: ENSMUSP00000059105
Gene: ENSMUSG00000050936

DomainStartEndE-ValueType
H2B 28 112 1.48e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098843
SMART Domains Protein: ENSMUSP00000096442
Gene: ENSMUSG00000074403

DomainStartEndE-ValueType
H3 34 136 2.12e-75 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177113
AA Change: V67E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135427
Gene: ENSMUSG00000105827
AA Change: V67E

DomainStartEndE-ValueType
H2B 28 124 1.43e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193036
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a replication-dependent histone that is a member of the histone H2B family. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,431,291 K316N probably damaging Het
Als2 A T 1: 59,203,069 V609E possibly damaging Het
Ank3 A G 10: 69,994,401 I71V probably damaging Het
Antxr2 T A 5: 97,949,201 D351V probably damaging Het
Arel1 A G 12: 84,941,939 V12A possibly damaging Het
Atad1 C T 19: 32,687,297 R239H possibly damaging Het
B3galnt2 A G 13: 13,991,509 T330A probably damaging Het
Bag6 T A 17: 35,143,624 I636N probably damaging Het
C1qtnf6 T C 15: 78,525,395 D84G probably damaging Het
Ceacam20 T C 7: 19,971,729 V215A possibly damaging Het
Chtf18 C T 17: 25,719,159 D967N probably damaging Het
Cntnap2 T A 6: 47,193,077 I1159K possibly damaging Het
Col2a1 T C 15: 97,998,567 D67G unknown Het
Csde1 T A 3: 103,054,754 V627E probably benign Het
Epb41l1 G A 2: 156,522,477 E969K probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gabbr2 C T 4: 46,736,459 R474Q probably damaging Het
Hap1 G T 11: 100,355,794 T95N probably benign Het
Jmjd1c A G 10: 67,240,012 K1886R probably damaging Het
Kndc1 A G 7: 139,923,802 D1007G probably damaging Het
Mcm2 C T 6: 88,887,836 A553T probably damaging Het
Memo1 T C 17: 74,202,307 Y239C possibly damaging Het
Meox2 GCACCACCACCACCACCACCA GCACCACCACCACCACCA 12: 37,109,031 probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Obsl1 A G 1: 75,492,078 probably benign Het
Olfr1082 T A 2: 86,594,414 H138L probably benign Het
Olfr1212 T A 2: 88,959,118 Y217* probably null Het
Pold3 A G 7: 100,096,407 S180P possibly damaging Het
Rbm12b2 T C 4: 12,095,135 S665P probably benign Het
Rfc4 A T 16: 23,120,943 S86T probably damaging Het
Rfx6 T A 10: 51,711,866 N277K possibly damaging Het
Ryr2 C A 13: 11,792,689 V865F possibly damaging Het
Skint4 T A 4: 112,119,822 probably null Het
Slc38a10 T C 11: 120,132,843 Y249C probably damaging Het
Slco1b2 A G 6: 141,657,510 T206A probably benign Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Tbc1d1 C T 5: 64,284,037 L655F probably damaging Het
Tpp2 A T 1: 43,940,146 I68F probably damaging Het
Trim30c G T 7: 104,382,081 T509K probably benign Het
Zfp827 G T 8: 79,076,438 K546N possibly damaging Het
Other mutations in Hist2h2bb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Hist2h2bb APN 3 96269809 unclassified probably benign
R0357:Hist2h2bb UTSW 3 96269788 missense probably null 0.04
R0882:Hist2h2bb UTSW 3 96269744 splice site probably null
R0976:Hist2h2bb UTSW 3 96270086 missense probably benign 0.19
R1473:Hist2h2bb UTSW 3 96270072 missense probably damaging 1.00
R1507:Hist2h2bb UTSW 3 96269873 missense probably damaging 1.00
R4503:Hist2h2bb UTSW 3 96269924 missense possibly damaging 0.84
R4751:Hist2h2bb UTSW 3 96269151 unclassified probably benign
R4808:Hist2h2bb UTSW 3 96270013 missense probably benign 0.00
R6585:Hist2h2bb UTSW 3 96270097 missense probably benign 0.17
R7527:Hist2h2bb UTSW 3 96269870 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AAATGCCGGATCCAGCGAAG -3'
(R):5'- AATCACGTCTCTGCTGCAC -3'

Sequencing Primer
(F):5'- ATCCAGCGAAGTCTGCTCCTG -3'
(R):5'- CACTTCACTTGGAGCTGGTGTAC -3'
Posted On2017-08-16