Incidental Mutation 'R6118:Mcm2'
ID485206
Institutional Source Beutler Lab
Gene Symbol Mcm2
Ensembl Gene ENSMUSG00000002870
Gene Nameminichromosome maintenance complex component 2
SynonymsBM28, CDCL1, Mcmd2
MMRRC Submission 044267-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6118 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location88883474-88898780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88887836 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 553 (A553T)
Ref Sequence ENSEMBL: ENSMUSP00000061923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058011] [ENSMUST00000205165]
Predicted Effect probably damaging
Transcript: ENSMUST00000058011
AA Change: A553T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061923
Gene: ENSMUSG00000002870
AA Change: A553T

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:MCM2_N 50 182 3.5e-20 PFAM
MCM 290 803 N/A SMART
Blast:MCM 816 891 3e-38 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204365
Predicted Effect probably benign
Transcript: ENSMUST00000205165
SMART Domains Protein: ENSMUSP00000145295
Gene: ENSMUSG00000002870

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein forms a complex with MCM4, 6, and 7, and has been shown to regulate the helicase activity of the complex. This protein is phosphorylated, and thus regulated by, protein kinases CDC2 and CDC7. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for non functional alleles at this locus die prematurely. There is an increased tumor incidence and abnormalities in a variety of systems in mice as they become moribund. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,431,291 K316N probably damaging Het
Als2 A T 1: 59,203,069 V609E possibly damaging Het
Ank3 A G 10: 69,994,401 I71V probably damaging Het
Antxr2 T A 5: 97,949,201 D351V probably damaging Het
Arel1 A G 12: 84,941,939 V12A possibly damaging Het
Atad1 C T 19: 32,687,297 R239H possibly damaging Het
B3galnt2 A G 13: 13,991,509 T330A probably damaging Het
Bag6 T A 17: 35,143,624 I636N probably damaging Het
C1qtnf6 T C 15: 78,525,395 D84G probably damaging Het
Ceacam20 T C 7: 19,971,729 V215A possibly damaging Het
Chtf18 C T 17: 25,719,159 D967N probably damaging Het
Cntnap2 T A 6: 47,193,077 I1159K possibly damaging Het
Col2a1 T C 15: 97,998,567 D67G unknown Het
Csde1 T A 3: 103,054,754 V627E probably benign Het
Epb41l1 G A 2: 156,522,477 E969K probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gabbr2 C T 4: 46,736,459 R474Q probably damaging Het
Hap1 G T 11: 100,355,794 T95N probably benign Het
Hist2h2bb T A 3: 96,269,951 V67E probably damaging Het
Jmjd1c A G 10: 67,240,012 K1886R probably damaging Het
Kndc1 A G 7: 139,923,802 D1007G probably damaging Het
Memo1 T C 17: 74,202,307 Y239C possibly damaging Het
Meox2 GCACCACCACCACCACCACCA GCACCACCACCACCACCA 12: 37,109,031 probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Obsl1 A G 1: 75,492,078 probably benign Het
Olfr1082 T A 2: 86,594,414 H138L probably benign Het
Olfr1212 T A 2: 88,959,118 Y217* probably null Het
Pold3 A G 7: 100,096,407 S180P possibly damaging Het
Rbm12b2 T C 4: 12,095,135 S665P probably benign Het
Rfc4 A T 16: 23,120,943 S86T probably damaging Het
Rfx6 T A 10: 51,711,866 N277K possibly damaging Het
Ryr2 C A 13: 11,792,689 V865F possibly damaging Het
Skint4 T A 4: 112,119,822 probably null Het
Slc38a10 T C 11: 120,132,843 Y249C probably damaging Het
Slco1b2 A G 6: 141,657,510 T206A probably benign Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Tbc1d1 C T 5: 64,284,037 L655F probably damaging Het
Tpp2 A T 1: 43,940,146 I68F probably damaging Het
Trim30c G T 7: 104,382,081 T509K probably benign Het
Zfp827 G T 8: 79,076,438 K546N possibly damaging Het
Other mutations in Mcm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mcm2 APN 6 88893401 missense probably benign 0.04
IGL01082:Mcm2 APN 6 88887877 missense probably benign 0.05
IGL01451:Mcm2 APN 6 88891966 splice site probably benign
IGL01534:Mcm2 APN 6 88887718 critical splice donor site probably null
IGL01670:Mcm2 APN 6 88887632 unclassified probably benign
IGL01724:Mcm2 APN 6 88886062 missense probably damaging 1.00
IGL01936:Mcm2 APN 6 88891726 missense probably damaging 1.00
IGL02082:Mcm2 APN 6 88888236 nonsense probably null
R0254:Mcm2 UTSW 6 88884016 missense probably damaging 0.99
R1673:Mcm2 UTSW 6 88892078 missense probably benign 0.12
R1740:Mcm2 UTSW 6 88884044 missense probably damaging 1.00
R1761:Mcm2 UTSW 6 88889788 missense possibly damaging 0.90
R1917:Mcm2 UTSW 6 88891803 missense possibly damaging 0.88
R2250:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R2307:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R2308:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R2309:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R2379:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3431:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3432:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3878:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3911:Mcm2 UTSW 6 88888252 missense probably damaging 0.98
R3934:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3936:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R4640:Mcm2 UTSW 6 88887804 missense possibly damaging 0.53
R4749:Mcm2 UTSW 6 88891991 missense possibly damaging 0.95
R5267:Mcm2 UTSW 6 88897450 missense probably benign
R5701:Mcm2 UTSW 6 88893091 missense probably damaging 1.00
R5872:Mcm2 UTSW 6 88884071 missense probably benign 0.05
R6152:Mcm2 UTSW 6 88889909 critical splice acceptor site probably benign
R6207:Mcm2 UTSW 6 88885862 missense probably benign 0.00
R6550:Mcm2 UTSW 6 88886959 critical splice donor site probably null
R7184:Mcm2 UTSW 6 88891794 missense probably damaging 1.00
R7303:Mcm2 UTSW 6 88887946 missense probably damaging 1.00
R8069:Mcm2 UTSW 6 88892057 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCCCAAGAGGCCTTAATAC -3'
(R):5'- ACTCTGATGGGCTGTCTCTG -3'

Sequencing Primer
(F):5'- GGCCTTAATACTCTCTAATAAAGCC -3'
(R):5'- CTCTCTCTTTGCTGAGGAACAGG -3'
Posted On2017-08-16