Incidental Mutation 'R6118:Pold3'
ID485210
Institutional Source Beutler Lab
Gene Symbol Pold3
Ensembl Gene ENSMUSG00000030726
Gene Namepolymerase (DNA-directed), delta 3, accessory subunit
SynonymsP66, C85233, P68, GC12, 2410142G14Rik
MMRRC Submission 044267-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6118 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location100082111-100121565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100096407 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 180 (S180P)
Ref Sequence ENSEMBL: ENSMUSP00000146986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032969] [ENSMUST00000127128] [ENSMUST00000156202] [ENSMUST00000208184] [ENSMUST00000208670]
Predicted Effect probably benign
Transcript: ENSMUST00000032969
AA Change: S286P

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032969
Gene: ENSMUSG00000030726
AA Change: S286P

DomainStartEndE-ValueType
Pfam:CDC27 19 461 1.6e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123675
Predicted Effect probably benign
Transcript: ENSMUST00000127128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130413
Predicted Effect probably benign
Transcript: ENSMUST00000156202
Predicted Effect possibly damaging
Transcript: ENSMUST00000208184
AA Change: S180P

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000208670
AA Change: S247P

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208704
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 66-kDa subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. The encoded protein plays a role in regulating the activity of DNA polymerase delta through interactions with other subunits and the processivity cofactor proliferating cell nuclear antigen (PCNA). Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,431,291 K316N probably damaging Het
Als2 A T 1: 59,203,069 V609E possibly damaging Het
Ank3 A G 10: 69,994,401 I71V probably damaging Het
Antxr2 T A 5: 97,949,201 D351V probably damaging Het
Arel1 A G 12: 84,941,939 V12A possibly damaging Het
Atad1 C T 19: 32,687,297 R239H possibly damaging Het
B3galnt2 A G 13: 13,991,509 T330A probably damaging Het
Bag6 T A 17: 35,143,624 I636N probably damaging Het
C1qtnf6 T C 15: 78,525,395 D84G probably damaging Het
Ceacam20 T C 7: 19,971,729 V215A possibly damaging Het
Chtf18 C T 17: 25,719,159 D967N probably damaging Het
Cntnap2 T A 6: 47,193,077 I1159K possibly damaging Het
Col2a1 T C 15: 97,998,567 D67G unknown Het
Csde1 T A 3: 103,054,754 V627E probably benign Het
Epb41l1 G A 2: 156,522,477 E969K probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gabbr2 C T 4: 46,736,459 R474Q probably damaging Het
Hap1 G T 11: 100,355,794 T95N probably benign Het
Hist2h2bb T A 3: 96,269,951 V67E probably damaging Het
Jmjd1c A G 10: 67,240,012 K1886R probably damaging Het
Kndc1 A G 7: 139,923,802 D1007G probably damaging Het
Mcm2 C T 6: 88,887,836 A553T probably damaging Het
Memo1 T C 17: 74,202,307 Y239C possibly damaging Het
Meox2 GCACCACCACCACCACCACCA GCACCACCACCACCACCA 12: 37,109,031 probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Obsl1 A G 1: 75,492,078 probably benign Het
Olfr1082 T A 2: 86,594,414 H138L probably benign Het
Olfr1212 T A 2: 88,959,118 Y217* probably null Het
Rbm12b2 T C 4: 12,095,135 S665P probably benign Het
Rfc4 A T 16: 23,120,943 S86T probably damaging Het
Rfx6 T A 10: 51,711,866 N277K possibly damaging Het
Ryr2 C A 13: 11,792,689 V865F possibly damaging Het
Skint4 T A 4: 112,119,822 probably null Het
Slc38a10 T C 11: 120,132,843 Y249C probably damaging Het
Slco1b2 A G 6: 141,657,510 T206A probably benign Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Tbc1d1 C T 5: 64,284,037 L655F probably damaging Het
Tpp2 A T 1: 43,940,146 I68F probably damaging Het
Trim30c G T 7: 104,382,081 T509K probably benign Het
Zfp827 G T 8: 79,076,438 K546N possibly damaging Het
Other mutations in Pold3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01891:Pold3 APN 7 100088145 splice site probably benign
IGL02101:Pold3 APN 7 100100496 missense probably damaging 0.99
IGL02402:Pold3 APN 7 100100411 splice site probably benign
IGL02541:Pold3 APN 7 100083672 missense probably damaging 1.00
IGL03145:Pold3 APN 7 100096512 missense probably damaging 1.00
R0522:Pold3 UTSW 7 100121383 missense probably damaging 1.00
R1263:Pold3 UTSW 7 100119683 missense possibly damaging 0.65
R1956:Pold3 UTSW 7 100088111 missense probably benign 0.03
R2508:Pold3 UTSW 7 100121383 missense probably damaging 1.00
R3933:Pold3 UTSW 7 100121401 missense probably damaging 1.00
R4135:Pold3 UTSW 7 100100647 nonsense probably null
R4354:Pold3 UTSW 7 100100617 missense possibly damaging 0.81
R5038:Pold3 UTSW 7 100121383 missense probably damaging 1.00
R6060:Pold3 UTSW 7 100100612 nonsense probably null
R6338:Pold3 UTSW 7 100088105 missense possibly damaging 0.94
R6466:Pold3 UTSW 7 100100632 missense probably benign 0.01
R7000:Pold3 UTSW 7 100106658 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTAGATGAGCTGTGGGC -3'
(R):5'- AAGCCCCAAAGCTGAATTTG -3'

Sequencing Primer
(F):5'- TGTCTTCATTCTCCTGGATGG -3'
(R):5'- TAACCTGGCACATAGTGGACTGTC -3'
Posted On2017-08-16