Incidental Mutation 'R6118:Trim30c'
ID485211
Institutional Source Beutler Lab
Gene Symbol Trim30c
Ensembl Gene ENSMUSG00000078616
Gene Nametripartite motif-containing 30C
SynonymsGm5598, Trim30-2
MMRRC Submission 044267-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R6118 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location104382065-104400837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 104382081 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 509 (T509K)
Ref Sequence ENSEMBL: ENSMUSP00000102441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106828]
Predicted Effect probably benign
Transcript: ENSMUST00000106828
AA Change: T509K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000102441
Gene: ENSMUSG00000078616
AA Change: T509K

DomainStartEndE-ValueType
RING 16 59 2.51e-10 SMART
BBOX 92 133 2.02e-14 SMART
low complexity region 197 229 N/A INTRINSIC
Pfam:SPRY 356 495 1.9e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,431,291 K316N probably damaging Het
Als2 A T 1: 59,203,069 V609E possibly damaging Het
Ank3 A G 10: 69,994,401 I71V probably damaging Het
Antxr2 T A 5: 97,949,201 D351V probably damaging Het
Arel1 A G 12: 84,941,939 V12A possibly damaging Het
Atad1 C T 19: 32,687,297 R239H possibly damaging Het
B3galnt2 A G 13: 13,991,509 T330A probably damaging Het
Bag6 T A 17: 35,143,624 I636N probably damaging Het
C1qtnf6 T C 15: 78,525,395 D84G probably damaging Het
Ceacam20 T C 7: 19,971,729 V215A possibly damaging Het
Chtf18 C T 17: 25,719,159 D967N probably damaging Het
Cntnap2 T A 6: 47,193,077 I1159K possibly damaging Het
Col2a1 T C 15: 97,998,567 D67G unknown Het
Csde1 T A 3: 103,054,754 V627E probably benign Het
Epb41l1 G A 2: 156,522,477 E969K probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gabbr2 C T 4: 46,736,459 R474Q probably damaging Het
Hap1 G T 11: 100,355,794 T95N probably benign Het
Hist2h2bb T A 3: 96,269,951 V67E probably damaging Het
Jmjd1c A G 10: 67,240,012 K1886R probably damaging Het
Kndc1 A G 7: 139,923,802 D1007G probably damaging Het
Mcm2 C T 6: 88,887,836 A553T probably damaging Het
Memo1 T C 17: 74,202,307 Y239C possibly damaging Het
Meox2 GCACCACCACCACCACCACCA GCACCACCACCACCACCA 12: 37,109,031 probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Obsl1 A G 1: 75,492,078 probably benign Het
Olfr1082 T A 2: 86,594,414 H138L probably benign Het
Olfr1212 T A 2: 88,959,118 Y217* probably null Het
Pold3 A G 7: 100,096,407 S180P possibly damaging Het
Rbm12b2 T C 4: 12,095,135 S665P probably benign Het
Rfc4 A T 16: 23,120,943 S86T probably damaging Het
Rfx6 T A 10: 51,711,866 N277K possibly damaging Het
Ryr2 C A 13: 11,792,689 V865F possibly damaging Het
Skint4 T A 4: 112,119,822 probably null Het
Slc38a10 T C 11: 120,132,843 Y249C probably damaging Het
Slco1b2 A G 6: 141,657,510 T206A probably benign Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Tbc1d1 C T 5: 64,284,037 L655F probably damaging Het
Tpp2 A T 1: 43,940,146 I68F probably damaging Het
Zfp827 G T 8: 79,076,438 K546N possibly damaging Het
Other mutations in Trim30c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Trim30c APN 7 104382182 nonsense probably null
IGL00573:Trim30c APN 7 104382631 missense possibly damaging 0.66
IGL01023:Trim30c APN 7 104382972 splice site probably benign
IGL01413:Trim30c APN 7 104382334 missense possibly damaging 0.85
IGL01418:Trim30c APN 7 104382334 missense possibly damaging 0.85
IGL02330:Trim30c APN 7 104382958 missense possibly damaging 0.61
IGL02389:Trim30c APN 7 104382174 missense probably benign 0.00
IGL03107:Trim30c APN 7 104382613 missense possibly damaging 0.95
R0195:Trim30c UTSW 7 104382429 missense probably benign
R0324:Trim30c UTSW 7 104383309 missense possibly damaging 0.79
R0826:Trim30c UTSW 7 104383481 missense probably benign 0.01
R0865:Trim30c UTSW 7 104390451 missense probably damaging 1.00
R1484:Trim30c UTSW 7 104383252 missense probably benign 0.00
R1513:Trim30c UTSW 7 104382689 missense probably benign 0.04
R1563:Trim30c UTSW 7 104382951 missense probably benign 0.00
R2220:Trim30c UTSW 7 104383267 missense probably benign
R2442:Trim30c UTSW 7 104382274 missense probably damaging 1.00
R5326:Trim30c UTSW 7 104388304 missense possibly damaging 0.89
R5777:Trim30c UTSW 7 104383331 missense probably benign 0.08
R6257:Trim30c UTSW 7 104390168 missense probably damaging 1.00
R6374:Trim30c UTSW 7 104390402 missense probably benign 0.01
R7387:Trim30c UTSW 7 104390190 missense probably damaging 1.00
R7419:Trim30c UTSW 7 104388265 missense probably benign 0.11
R7500:Trim30c UTSW 7 104387551 missense probably benign 0.00
R7542:Trim30c UTSW 7 104382218 missense possibly damaging 0.95
Z1176:Trim30c UTSW 7 104383258 missense not run
Predicted Primers PCR Primer
(F):5'- TCAGCATATACTCTCACAGAAATGG -3'
(R):5'- ACCGGGAAGCTTGTACTCTC -3'

Sequencing Primer
(F):5'- CTCTCACAGAAATGGATTCTATAGC -3'
(R):5'- GGAAGCTTGTACTCTCTCATTTTATG -3'
Posted On2017-08-16