Incidental Mutation 'R6118:Arel1'
ID485221
Institutional Source Beutler Lab
Gene Symbol Arel1
Ensembl Gene ENSMUSG00000042350
Gene Nameapoptosis resistant E3 ubiquitin protein ligase 1
Synonyms1110018G07Rik
MMRRC Submission 044267-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.523) question?
Stock #R6118 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location84918148-84970900 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84941939 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 12 (V12A)
Ref Sequence ENSEMBL: ENSMUSP00000127426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043169] [ENSMUST00000163231] [ENSMUST00000163372] [ENSMUST00000165093] [ENSMUST00000165886] [ENSMUST00000167448] [ENSMUST00000169161]
Predicted Effect probably benign
Transcript: ENSMUST00000043169
AA Change: V12A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000048780
Gene: ENSMUSG00000042350
AA Change: V12A

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
IG_FLMN 56 160 4.53e-2 SMART
low complexity region 346 360 N/A INTRINSIC
Blast:HECTc 401 474 6e-39 BLAST
HECTc 481 823 1.04e-158 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163231
AA Change: V12A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000129213
Gene: ENSMUSG00000042350
AA Change: V12A

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
IG_FLMN 56 160 4.53e-2 SMART
low complexity region 346 360 N/A INTRINSIC
Blast:HECTc 386 474 1e-51 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163372
AA Change: V12A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000130259
Gene: ENSMUSG00000042350
AA Change: V12A

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Blast:IG_FLMN 56 81 7e-13 BLAST
SCOP:d1qfha1 56 81 4e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165093
AA Change: V12A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129147
Gene: ENSMUSG00000042350
AA Change: V12A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165886
AA Change: V12A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126508
Gene: ENSMUSG00000042350
AA Change: V12A

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167448
AA Change: V12A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127426
Gene: ENSMUSG00000042350
AA Change: V12A

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169161
AA Change: V12A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126523
Gene: ENSMUSG00000042350
AA Change: V12A

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
IG_FLMN 56 160 4.53e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,431,291 K316N probably damaging Het
Als2 A T 1: 59,203,069 V609E possibly damaging Het
Ank3 A G 10: 69,994,401 I71V probably damaging Het
Antxr2 T A 5: 97,949,201 D351V probably damaging Het
Atad1 C T 19: 32,687,297 R239H possibly damaging Het
B3galnt2 A G 13: 13,991,509 T330A probably damaging Het
Bag6 T A 17: 35,143,624 I636N probably damaging Het
C1qtnf6 T C 15: 78,525,395 D84G probably damaging Het
Ceacam20 T C 7: 19,971,729 V215A possibly damaging Het
Chtf18 C T 17: 25,719,159 D967N probably damaging Het
Cntnap2 T A 6: 47,193,077 I1159K possibly damaging Het
Col2a1 T C 15: 97,998,567 D67G unknown Het
Csde1 T A 3: 103,054,754 V627E probably benign Het
Epb41l1 G A 2: 156,522,477 E969K probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gabbr2 C T 4: 46,736,459 R474Q probably damaging Het
Hap1 G T 11: 100,355,794 T95N probably benign Het
Hist2h2bb T A 3: 96,269,951 V67E probably damaging Het
Jmjd1c A G 10: 67,240,012 K1886R probably damaging Het
Kndc1 A G 7: 139,923,802 D1007G probably damaging Het
Mcm2 C T 6: 88,887,836 A553T probably damaging Het
Memo1 T C 17: 74,202,307 Y239C possibly damaging Het
Meox2 GCACCACCACCACCACCACCA GCACCACCACCACCACCA 12: 37,109,031 probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Obsl1 A G 1: 75,492,078 probably benign Het
Olfr1082 T A 2: 86,594,414 H138L probably benign Het
Olfr1212 T A 2: 88,959,118 Y217* probably null Het
Pold3 A G 7: 100,096,407 S180P possibly damaging Het
Rbm12b2 T C 4: 12,095,135 S665P probably benign Het
Rfc4 A T 16: 23,120,943 S86T probably damaging Het
Rfx6 T A 10: 51,711,866 N277K possibly damaging Het
Ryr2 C A 13: 11,792,689 V865F possibly damaging Het
Skint4 T A 4: 112,119,822 probably null Het
Slc38a10 T C 11: 120,132,843 Y249C probably damaging Het
Slco1b2 A G 6: 141,657,510 T206A probably benign Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Tbc1d1 C T 5: 64,284,037 L655F probably damaging Het
Tpp2 A T 1: 43,940,146 I68F probably damaging Het
Trim30c G T 7: 104,382,081 T509K probably benign Het
Zfp827 G T 8: 79,076,438 K546N possibly damaging Het
Other mutations in Arel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Arel1 APN 12 84934162 missense probably damaging 0.98
IGL01532:Arel1 APN 12 84934162 missense possibly damaging 0.46
IGL01640:Arel1 APN 12 84920701 missense probably damaging 1.00
IGL02522:Arel1 APN 12 84927910 missense probably damaging 1.00
IGL02675:Arel1 APN 12 84930228 missense probably damaging 1.00
IGL02867:Arel1 APN 12 84934323 missense probably benign 0.01
IGL03231:Arel1 APN 12 84934310 missense probably benign
R0244:Arel1 UTSW 12 84920693 missense probably damaging 0.99
R0363:Arel1 UTSW 12 84934253 missense probably damaging 1.00
R0538:Arel1 UTSW 12 84941837 missense probably damaging 1.00
R1633:Arel1 UTSW 12 84926283 missense probably damaging 1.00
R1965:Arel1 UTSW 12 84940399 critical splice acceptor site probably null
R2161:Arel1 UTSW 12 84921256 critical splice donor site probably null
R4691:Arel1 UTSW 12 84930249 splice site probably null
R4958:Arel1 UTSW 12 84926304 missense possibly damaging 0.89
R4999:Arel1 UTSW 12 84931767 missense probably damaging 0.99
R5088:Arel1 UTSW 12 84924115 missense probably damaging 1.00
R5154:Arel1 UTSW 12 84931773 missense probably benign
R5939:Arel1 UTSW 12 84926292 missense probably damaging 0.99
R5945:Arel1 UTSW 12 84926347 missense probably benign 0.20
R6421:Arel1 UTSW 12 84934345 missense probably damaging 1.00
R6458:Arel1 UTSW 12 84940385 missense possibly damaging 0.87
R7290:Arel1 UTSW 12 84941945 missense probably benign 0.08
R7490:Arel1 UTSW 12 84941911 missense probably damaging 0.97
R7732:Arel1 UTSW 12 84927889 missense probably benign 0.45
R7743:Arel1 UTSW 12 84940269 missense probably damaging 1.00
R8021:Arel1 UTSW 12 84934958 missense possibly damaging 0.47
R8083:Arel1 UTSW 12 84940362 missense probably benign 0.00
X0066:Arel1 UTSW 12 84934382 missense probably damaging 0.99
X0066:Arel1 UTSW 12 84943329 splice site probably null
Predicted Primers
Posted On2017-08-16