Incidental Mutation 'R6118:Memo1'
ID485230
Institutional Source Beutler Lab
Gene Symbol Memo1
Ensembl Gene ENSMUSG00000058704
Gene Namemediator of cell motility 1
Synonyms0610016J10Rik, D930048L02Rik
MMRRC Submission 044267-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6118 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location74200706-74294883 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74202307 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 239 (Y239C)
Ref Sequence ENSEMBL: ENSMUSP00000077553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078459]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078459
AA Change: Y239C

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000077553
Gene: ENSMUSG00000058704
AA Change: Y239C

DomainStartEndE-ValueType
Pfam:Memo 9 293 3.7e-84 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a floxed allele activated postnatally exhibit a reduced life span, increased insulin sensitivity, small stature, graying hair, alopecia, kyphosis, loss of subcutaneous fat, loss of spermatozoa in the epididymis and increased active vitamin D. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,431,291 K316N probably damaging Het
Als2 A T 1: 59,203,069 V609E possibly damaging Het
Ank3 A G 10: 69,994,401 I71V probably damaging Het
Antxr2 T A 5: 97,949,201 D351V probably damaging Het
Arel1 A G 12: 84,941,939 V12A possibly damaging Het
Atad1 C T 19: 32,687,297 R239H possibly damaging Het
B3galnt2 A G 13: 13,991,509 T330A probably damaging Het
Bag6 T A 17: 35,143,624 I636N probably damaging Het
C1qtnf6 T C 15: 78,525,395 D84G probably damaging Het
Ceacam20 T C 7: 19,971,729 V215A possibly damaging Het
Chtf18 C T 17: 25,719,159 D967N probably damaging Het
Cntnap2 T A 6: 47,193,077 I1159K possibly damaging Het
Col2a1 T C 15: 97,998,567 D67G unknown Het
Csde1 T A 3: 103,054,754 V627E probably benign Het
Epb41l1 G A 2: 156,522,477 E969K probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gabbr2 C T 4: 46,736,459 R474Q probably damaging Het
Hap1 G T 11: 100,355,794 T95N probably benign Het
Hist2h2bb T A 3: 96,269,951 V67E probably damaging Het
Jmjd1c A G 10: 67,240,012 K1886R probably damaging Het
Kndc1 A G 7: 139,923,802 D1007G probably damaging Het
Mcm2 C T 6: 88,887,836 A553T probably damaging Het
Meox2 GCACCACCACCACCACCACCA GCACCACCACCACCACCA 12: 37,109,031 probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Obsl1 A G 1: 75,492,078 probably benign Het
Olfr1082 T A 2: 86,594,414 H138L probably benign Het
Olfr1212 T A 2: 88,959,118 Y217* probably null Het
Pold3 A G 7: 100,096,407 S180P possibly damaging Het
Rbm12b2 T C 4: 12,095,135 S665P probably benign Het
Rfc4 A T 16: 23,120,943 S86T probably damaging Het
Rfx6 T A 10: 51,711,866 N277K possibly damaging Het
Ryr2 C A 13: 11,792,689 V865F possibly damaging Het
Skint4 T A 4: 112,119,822 probably null Het
Slc38a10 T C 11: 120,132,843 Y249C probably damaging Het
Slco1b2 A G 6: 141,657,510 T206A probably benign Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Tbc1d1 C T 5: 64,284,037 L655F probably damaging Het
Tpp2 A T 1: 43,940,146 I68F probably damaging Het
Trim30c G T 7: 104,382,081 T509K probably benign Het
Zfp827 G T 8: 79,076,438 K546N possibly damaging Het
Other mutations in Memo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Memo1 APN 17 74241981 nonsense probably null
IGL01570:Memo1 APN 17 74217108 splice site probably benign
IGL02709:Memo1 APN 17 74245032 missense probably damaging 1.00
IGL03172:Memo1 APN 17 74245001 missense probably damaging 1.00
R0067:Memo1 UTSW 17 74225458 missense probably damaging 1.00
R1068:Memo1 UTSW 17 74225555 missense probably damaging 1.00
R1962:Memo1 UTSW 17 74245008 missense possibly damaging 0.54
R1964:Memo1 UTSW 17 74245008 missense possibly damaging 0.54
R2029:Memo1 UTSW 17 74245054 missense probably null 0.99
R3236:Memo1 UTSW 17 74202352 missense probably damaging 1.00
R4284:Memo1 UTSW 17 74255298 critical splice acceptor site probably null
R4285:Memo1 UTSW 17 74255298 critical splice acceptor site probably null
R4287:Memo1 UTSW 17 74255298 critical splice acceptor site probably null
R4427:Memo1 UTSW 17 74202307 missense probably benign 0.01
R4583:Memo1 UTSW 17 74258461 nonsense probably null
R4607:Memo1 UTSW 17 74258461 nonsense probably null
R4608:Memo1 UTSW 17 74258461 nonsense probably null
R6769:Memo1 UTSW 17 74201278 missense probably damaging 1.00
R6771:Memo1 UTSW 17 74201278 missense probably damaging 1.00
R7226:Memo1 UTSW 17 74202343 missense probably damaging 1.00
R7996:Memo1 UTSW 17 74258496 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCTCTTCCAAATAATTGTGTTGAC -3'
(R):5'- TGAAGGTGCCTTACAAGCATC -3'

Sequencing Primer
(F):5'- TGTGTTGACAGACATTATTGATCTG -3'
(R):5'- GGGTATGAGTATTATAGA -3'
Posted On2017-08-16