Incidental Mutation 'R6101:Rpn2'
ID485237
Institutional Source Beutler Lab
Gene Symbol Rpn2
Ensembl Gene ENSMUSG00000027642
Gene Nameribophorin II
SynonymsRpn-2, 1300012C06Rik
MMRRC Submission 044251-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6101 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location157279017-157326319 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 157310188 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029171] [ENSMUST00000029171] [ENSMUST00000116380]
Predicted Effect probably null
Transcript: ENSMUST00000029171
SMART Domains Protein: ENSMUSP00000029171
Gene: ENSMUSG00000027642

DomainStartEndE-ValueType
Pfam:Ribophorin_II 2 71 1.5e-15 PFAM
Pfam:Ribophorin_II 68 596 3.5e-247 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000029171
SMART Domains Protein: ENSMUSP00000029171
Gene: ENSMUSG00000027642

DomainStartEndE-ValueType
Pfam:Ribophorin_II 2 71 1.5e-15 PFAM
Pfam:Ribophorin_II 68 596 3.5e-247 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000116380
SMART Domains Protein: ENSMUSP00000112081
Gene: ENSMUSG00000027642

DomainStartEndE-ValueType
Pfam:Ribophorin_II 9 627 1.8e-223 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127252
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein is similar in sequence to the yeast oligosaccharyl transferase subunit SWP1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,970,759 C570S probably damaging Het
Adh6b T A 3: 138,357,710 I350K possibly damaging Het
Ahnak G A 19: 9,004,099 V916I probably benign Het
Aldh4a1 C T 4: 139,638,495 P266S possibly damaging Het
Arhgap11a G A 2: 113,834,874 R460* probably null Het
Chl1 A T 6: 103,693,032 D477V probably damaging Het
Clstn3 A T 6: 124,461,670 L45Q probably damaging Het
Cnot7 C T 8: 40,510,037 R32Q probably benign Het
Csrnp1 T C 9: 119,973,485 D220G probably damaging Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Glul T A 1: 153,906,431 Y137* probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Igha T A 12: 113,256,397 probably benign Het
Kif2b A G 11: 91,575,988 S490P probably benign Het
Kxd1 A T 8: 70,519,939 N33K probably benign Het
Lrrk2 T C 15: 91,723,135 I567T probably benign Het
Man2a2 T C 7: 80,367,001 D355G probably damaging Het
Map6 T C 7: 99,268,107 V29A probably damaging Het
Mical3 A T 6: 121,033,710 V437D probably damaging Het
Mief1 T C 15: 80,249,740 Y333H probably benign Het
Olfr1303 A G 2: 111,814,253 F158L probably benign Het
Olfr533 T A 7: 140,466,519 V106D probably benign Het
Olfr917 A G 9: 38,665,620 S75P probably damaging Het
Olfr926 T C 9: 38,877,308 L44P possibly damaging Het
Pak1ip1 T A 13: 41,004,885 L78Q probably damaging Het
Pikfyve A G 1: 65,264,345 probably null Het
Pinlyp C T 7: 24,545,980 R5K possibly damaging Het
Pkd1l3 A G 8: 109,640,846 D1225G probably damaging Het
Pnmal2 T A 7: 16,946,568 S492R probably benign Het
Postn A G 3: 54,372,220 probably null Het
Ptprq A G 10: 107,580,266 Y1724H possibly damaging Het
Scn5a A G 9: 119,522,650 V755A probably damaging Het
Slc22a30 T C 19: 8,337,868 probably null Het
Specc1l T C 10: 75,248,632 S730P probably damaging Het
Steap2 T A 5: 5,675,891 I378F possibly damaging Het
Tdrd12 A T 7: 35,481,133 Y818* probably null Het
Thbs4 G T 13: 92,775,485 Q246K possibly damaging Het
Tnfsf10 A G 3: 27,335,549 Y253C probably damaging Het
Tnpo3 G T 6: 29,588,043 C125* probably null Het
Trim58 A G 11: 58,651,615 N467S probably benign Het
Trpm6 C T 19: 18,853,748 R1326* probably null Het
Zc3hav1l A G 6: 38,293,077 V279A probably benign Het
Zfp618 A T 4: 63,133,241 Q753L probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zkscan17 A T 11: 59,503,575 C67S probably damaging Het
Other mutations in Rpn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Rpn2 APN 2 157314913 missense probably damaging 1.00
IGL01894:Rpn2 APN 2 157294173 missense probably benign 0.45
IGL02104:Rpn2 APN 2 157321827 missense probably damaging 1.00
IGL02368:Rpn2 APN 2 157302408 missense probably benign
IGL02819:Rpn2 APN 2 157316210 critical splice donor site probably null
R0932:Rpn2 UTSW 2 157283771 missense possibly damaging 0.66
R1666:Rpn2 UTSW 2 157294155 missense possibly damaging 0.93
R1668:Rpn2 UTSW 2 157294155 missense possibly damaging 0.93
R1713:Rpn2 UTSW 2 157314968 missense probably damaging 0.99
R2276:Rpn2 UTSW 2 157310288 missense possibly damaging 0.64
R2279:Rpn2 UTSW 2 157310288 missense possibly damaging 0.64
R3409:Rpn2 UTSW 2 157290652 missense possibly damaging 0.91
R3411:Rpn2 UTSW 2 157290652 missense possibly damaging 0.91
R3777:Rpn2 UTSW 2 157299557 missense probably damaging 0.99
R4004:Rpn2 UTSW 2 157318008 missense probably damaging 1.00
R4575:Rpn2 UTSW 2 157295324 missense probably damaging 1.00
R4613:Rpn2 UTSW 2 157302425 missense possibly damaging 0.87
R4856:Rpn2 UTSW 2 157318044 critical splice donor site probably null
R4886:Rpn2 UTSW 2 157318044 critical splice donor site probably null
R5491:Rpn2 UTSW 2 157297383 missense probably damaging 0.99
R5526:Rpn2 UTSW 2 157323267 missense probably damaging 1.00
R5633:Rpn2 UTSW 2 157283596 missense possibly damaging 0.81
R5718:Rpn2 UTSW 2 157321827 missense probably damaging 1.00
R5772:Rpn2 UTSW 2 157295345 missense probably damaging 1.00
R6618:Rpn2 UTSW 2 157321861 missense probably benign
R6698:Rpn2 UTSW 2 157297410 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GTCTCGAAGACTCCTATCGTAG -3'
(R):5'- CACAGTGCCTCAGTATGCTC -3'

Sequencing Primer
(F):5'- AAGTGCAAGCTCATCCTTGG -3'
(R):5'- AGTATGCTCTTTCCAGCTCTGAAG -3'
Posted On2017-08-16