Incidental Mutation 'R6101:Tnfsf10'
ID485238
Institutional Source Beutler Lab
Gene Symbol Tnfsf10
Ensembl Gene ENSMUSG00000039304
Gene Nametumor necrosis factor (ligand) superfamily, member 10
SynonymsA330042I21Rik, Trail, APO-2L
MMRRC Submission 044251-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6101 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location27317028-27342427 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27335549 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 253 (Y253C)
Ref Sequence ENSEMBL: ENSMUSP00000040271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046383] [ENSMUST00000174840]
Predicted Effect probably damaging
Transcript: ENSMUST00000046383
AA Change: Y253C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040271
Gene: ENSMUSG00000039304
AA Change: Y253C

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
TNF 146 290 5.35e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174840
SMART Domains Protein: ENSMUSP00000133917
Gene: ENSMUSG00000039304

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:TNF 156 226 7.1e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This protein preferentially induces apoptosis in transformed and tumor cells, but does not appear to kill normal cells although it is expressed at a significant level in most normal tissues. This protein binds to several members of TNF receptor superfamily including TNFRSF10A/TRAILR1, TNFRSF10B/TRAILR2, TNFRSF10C/TRAILR3, TNFRSF10D/TRAILR4, and possibly also to TNFRSF11B/OPG. The activity of this protein may be modulated by binding to the decoy receptors TNFRSF10C/TRAILR3, TNFRSF10D/TRAILR4, and TNFRSF11B/OPG that cannot induce apoptosis. The binding of this protein to its receptors has been shown to trigger the activation of MAPK8/JNK, caspase 8, and caspase 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygotes for a null allele show thymus hyperplasia, abnormal negative T cell selection, increased susceptibility to autoimmune diseases and to tumor initiation and metastasis, and resistance to induced hepatitis. Homozygotes for another null allele are unable to control A20 lymphoma progression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,970,759 C570S probably damaging Het
Adh6b T A 3: 138,357,710 I350K possibly damaging Het
Ahnak G A 19: 9,004,099 V916I probably benign Het
Aldh4a1 C T 4: 139,638,495 P266S possibly damaging Het
Arhgap11a G A 2: 113,834,874 R460* probably null Het
Chl1 A T 6: 103,693,032 D477V probably damaging Het
Clstn3 A T 6: 124,461,670 L45Q probably damaging Het
Cnot7 C T 8: 40,510,037 R32Q probably benign Het
Csrnp1 T C 9: 119,973,485 D220G probably damaging Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Glul T A 1: 153,906,431 Y137* probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Igha T A 12: 113,256,397 probably benign Het
Kif2b A G 11: 91,575,988 S490P probably benign Het
Kxd1 A T 8: 70,519,939 N33K probably benign Het
Lrrk2 T C 15: 91,723,135 I567T probably benign Het
Man2a2 T C 7: 80,367,001 D355G probably damaging Het
Map6 T C 7: 99,268,107 V29A probably damaging Het
Mical3 A T 6: 121,033,710 V437D probably damaging Het
Mief1 T C 15: 80,249,740 Y333H probably benign Het
Olfr1303 A G 2: 111,814,253 F158L probably benign Het
Olfr533 T A 7: 140,466,519 V106D probably benign Het
Olfr917 A G 9: 38,665,620 S75P probably damaging Het
Olfr926 T C 9: 38,877,308 L44P possibly damaging Het
Pak1ip1 T A 13: 41,004,885 L78Q probably damaging Het
Pikfyve A G 1: 65,264,345 probably null Het
Pinlyp C T 7: 24,545,980 R5K possibly damaging Het
Pkd1l3 A G 8: 109,640,846 D1225G probably damaging Het
Pnmal2 T A 7: 16,946,568 S492R probably benign Het
Postn A G 3: 54,372,220 probably null Het
Ptprq A G 10: 107,580,266 Y1724H possibly damaging Het
Rpn2 T A 2: 157,310,188 probably null Het
Scn5a A G 9: 119,522,650 V755A probably damaging Het
Slc22a30 T C 19: 8,337,868 probably null Het
Specc1l T C 10: 75,248,632 S730P probably damaging Het
Steap2 T A 5: 5,675,891 I378F possibly damaging Het
Tdrd12 A T 7: 35,481,133 Y818* probably null Het
Thbs4 G T 13: 92,775,485 Q246K possibly damaging Het
Tnpo3 G T 6: 29,588,043 C125* probably null Het
Trim58 A G 11: 58,651,615 N467S probably benign Het
Trpm6 C T 19: 18,853,748 R1326* probably null Het
Zc3hav1l A G 6: 38,293,077 V279A probably benign Het
Zfp618 A T 4: 63,133,241 Q753L probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zkscan17 A T 11: 59,503,575 C67S probably damaging Het
Other mutations in Tnfsf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02155:Tnfsf10 APN 3 27335231 missense possibly damaging 0.71
IGL03071:Tnfsf10 APN 3 27335620 missense probably damaging 1.00
IGL03157:Tnfsf10 APN 3 27325957 missense possibly damaging 0.77
IGL03226:Tnfsf10 APN 3 27335448 nonsense probably null
R4051:Tnfsf10 UTSW 3 27335354 missense probably damaging 1.00
R4679:Tnfsf10 UTSW 3 27335579 missense probably damaging 0.99
R5799:Tnfsf10 UTSW 3 27335593 missense probably damaging 1.00
R6105:Tnfsf10 UTSW 3 27335549 missense probably damaging 1.00
R6882:Tnfsf10 UTSW 3 27326033 missense possibly damaging 0.95
R7362:Tnfsf10 UTSW 3 27335348 missense probably damaging 1.00
R7873:Tnfsf10 UTSW 3 27335659 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGAAGCTGAAGACGCTTC -3'
(R):5'- TGAGGTTTCTACAGCCAGGC -3'

Sequencing Primer
(F):5'- TGAAGACGCTTCCAAGATGGTCTC -3'
(R):5'- GAGGTTTCTACAGCCAGGCCATATC -3'
Posted On2017-08-16