Mutagenetix > Incidental Mutations

Incidental Mutation 'R6101:Postn'

485239

Institutional Source

Beutler Lab

Gene Symbol

Postn

Ensembl Gene

ENSMUSG00000027750

Gene Name

periostin, osteoblast specific factor

Synonyms

peri, A630052E07Rik, OSF-2, Osf2, Periostin

MMRRC Submission

044251-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6101 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

54361109-54391037 bp(+) (GRCm38)

Type of Mutation

splice site (4 bp from exon)

DNA Base Change (assembly)

A to G at 54372220 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000112735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073012] [ENSMUST00000081564] [ENSMUST00000107985] [ENSMUST00000117373]

Predicted Effect

probably null
Transcript: ENSMUST00000073012

SMART Domains

Protein: ENSMUSP00000072773
Gene: ENSMUSG00000027750

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
FAS1	135	235	7.81e-30	SMART
FAS1	272	370	2.31e-32	SMART
FAS1	406	497	2.43e-17	SMART
FAS1	534	633	2.5e-28	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000081564

SMART Domains

Protein: ENSMUSP00000080276
Gene: ENSMUSG00000027750

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
FAS1	135	235	7.81e-30	SMART
FAS1	272	370	2.31e-32	SMART
FAS1	406	497	2.43e-17	SMART
FAS1	534	633	2.5e-28	SMART
low complexity region	669	680	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000107985

SMART Domains

Protein: ENSMUSP00000103619
Gene: ENSMUSG00000027750

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
FAS1	135	235	7.81e-30	SMART
FAS1	272	370	2.31e-32	SMART
FAS1	406	497	2.43e-17	SMART
FAS1	534	633	2.5e-28	SMART
low complexity region	669	680	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000117373

SMART Domains

Protein: ENSMUSP00000112735
Gene: ENSMUSG00000027750

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
FAS1	135	235	7.81e-30	SMART
FAS1	272	370	2.31e-32	SMART
FAS1	406	497	2.43e-17	SMART
FAS1	534	633	2.5e-28	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a secreted extracellular matrix protein that functions in tissue development and regeneration, including wound healing and ventricular remodeling following myocardial infarction. The encoded protein binds to integrins to support adhesion and migration of epithelial cells. This protein plays a role in cancer stem cell maintenance and metastasis. Mice lacking this gene exhibit cardiac valve disease, and skeletal and dental defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice display abnormalities of the enamel, periodontal ligament, ameloblasts, and incisors. For one allele changing the hardness of the food alters the severity of the abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam9	A	T	8: 24,970,759	C570S	probably damaging	Het
Adh6b	T	A	3: 138,357,710	I350K	possibly damaging	Het
Ahnak	G	A	19: 9,004,099	V916I	probably benign	Het
Aldh4a1	C	T	4: 139,638,495	P266S	possibly damaging	Het
Arhgap11a	G	A	2: 113,834,874	R460*	probably null	Het
Chl1	A	T	6: 103,693,032	D477V	probably damaging	Het
Clstn3	A	T	6: 124,461,670	L45Q	probably damaging	Het
Cnot7	C	T	8: 40,510,037	R32Q	probably benign	Het
Csrnp1	T	C	9: 119,973,485	D220G	probably damaging	Het
Cyb5a	G	A	18: 84,871,593	R49Q	possibly damaging	Het
Fblim1	G	A	4: 141,584,722	R231C	probably damaging	Het
Glul	T	A	1: 153,906,431	Y137*	probably null	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Igha	T	A	12: 113,256,397		probably benign	Het
Kif2b	A	G	11: 91,575,988	S490P	probably benign	Het
Kxd1	A	T	8: 70,519,939	N33K	probably benign	Het
Lrrk2	T	C	15: 91,723,135	I567T	probably benign	Het
Man2a2	T	C	7: 80,367,001	D355G	probably damaging	Het
Map6	T	C	7: 99,268,107	V29A	probably damaging	Het
Mical3	A	T	6: 121,033,710	V437D	probably damaging	Het
Mief1	T	C	15: 80,249,740	Y333H	probably benign	Het
Olfr1303	A	G	2: 111,814,253	F158L	probably benign	Het
Olfr533	T	A	7: 140,466,519	V106D	probably benign	Het
Olfr917	A	G	9: 38,665,620	S75P	probably damaging	Het
Olfr926	T	C	9: 38,877,308	L44P	possibly damaging	Het
Pak1ip1	T	A	13: 41,004,885	L78Q	probably damaging	Het
Pikfyve	A	G	1: 65,264,345		probably null	Het
Pinlyp	C	T	7: 24,545,980	R5K	possibly damaging	Het
Pkd1l3	A	G	8: 109,640,846	D1225G	probably damaging	Het
Pnmal2	T	A	7: 16,946,568	S492R	probably benign	Het
Ptprq	A	G	10: 107,580,266	Y1724H	possibly damaging	Het
Rpn2	T	A	2: 157,310,188		probably null	Het
Scn5a	A	G	9: 119,522,650	V755A	probably damaging	Het
Slc22a30	T	C	19: 8,337,868		probably null	Het
Specc1l	T	C	10: 75,248,632	S730P	probably damaging	Het
Steap2	T	A	5: 5,675,891	I378F	possibly damaging	Het
Tdrd12	A	T	7: 35,481,133	Y818*	probably null	Het
Thbs4	G	T	13: 92,775,485	Q246K	possibly damaging	Het
Tnfsf10	A	G	3: 27,335,549	Y253C	probably damaging	Het
Tnpo3	G	T	6: 29,588,043	C125*	probably null	Het
Trim58	A	G	11: 58,651,615	N467S	probably benign	Het
Trpm6	C	T	19: 18,853,748	R1326*	probably null	Het
Zc3hav1l	A	G	6: 38,293,077	V279A	probably benign	Het
Zfp618	A	T	4: 63,133,241	Q753L	probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het
Zkscan17	A	T	11: 59,503,575	C67S	probably damaging	Het

Other mutations in Postn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Postn	APN	3	54373728	missense	probably damaging	1.00
IGL00567:Postn	APN	3	54384523	missense	probably benign
IGL00742:Postn	APN	3	54372894	missense	possibly damaging	0.81
IGL00971:Postn	APN	3	54369276	missense	possibly damaging	0.88
IGL01105:Postn	APN	3	54362710	missense	probably damaging	1.00
IGL01460:Postn	APN	3	54375158	unclassified	probably benign
IGL01609:Postn	APN	3	54369228	missense	probably damaging	0.99
IGL01878:Postn	APN	3	54383480	splice site	probably null
IGL01885:Postn	APN	3	54376034	unclassified	probably benign
IGL02040:Postn	APN	3	54362689	missense	probably benign
IGL02431:Postn	APN	3	54375096	missense	probably damaging	0.99
IGL02578:Postn	APN	3	54377204	missense	possibly damaging	0.93
IGL02943:Postn	APN	3	54377608	critical splice donor site	probably null
IGL03307:Postn	APN	3	54375127	missense	probably benign	0.32
sticklike	UTSW	3	54372106	missense	probably damaging	1.00
R0117:Postn	UTSW	3	54383481	splice site	probably benign
R0270:Postn	UTSW	3	54384550	missense	probably damaging	0.98
R0410:Postn	UTSW	3	54385277	missense	possibly damaging	0.93
R0548:Postn	UTSW	3	54367576	nonsense	probably null
R0734:Postn	UTSW	3	54362715	missense	probably damaging	1.00
R1648:Postn	UTSW	3	54376101	missense	probably damaging	1.00
R1796:Postn	UTSW	3	54373756	missense	probably damaging	1.00
R1823:Postn	UTSW	3	54385287	critical splice donor site	probably null
R1938:Postn	UTSW	3	54377612	splice site	probably null
R2311:Postn	UTSW	3	54385223	missense	probably damaging	0.98
R2566:Postn	UTSW	3	54376953	missense	probably damaging	0.97
R2938:Postn	UTSW	3	54370310	missense	probably damaging	1.00
R4105:Postn	UTSW	3	54376041	missense	probably damaging	1.00
R4394:Postn	UTSW	3	54370955	missense	probably damaging	1.00
R4620:Postn	UTSW	3	54376993	missense	probably damaging	1.00
R4628:Postn	UTSW	3	54372157	missense	probably damaging	1.00
R4697:Postn	UTSW	3	54375071	missense	probably damaging	1.00
R4709:Postn	UTSW	3	54384610	intron	probably benign
R4952:Postn	UTSW	3	54390315	utr 3 prime	probably benign
R5303:Postn	UTSW	3	54377597	missense	probably damaging	1.00
R5704:Postn	UTSW	3	54372106	missense	probably damaging	1.00
R5902:Postn	UTSW	3	54372089	missense	probably benign	0.03
R5914:Postn	UTSW	3	54373800	nonsense	probably null
R6032:Postn	UTSW	3	54376716	missense	possibly damaging	0.53
R6032:Postn	UTSW	3	54376716	missense	possibly damaging	0.53
R6105:Postn	UTSW	3	54372220	splice site	probably null
R6334:Postn	UTSW	3	54385282	missense	probably benign
R7131:Postn	UTSW	3	54362635	missense	probably damaging	1.00
R7322:Postn	UTSW	3	54370280	missense	probably damaging	1.00
R7430:Postn	UTSW	3	54370202	missense	probably damaging	1.00
R7497:Postn	UTSW	3	54362670	missense	probably damaging	1.00
R8245:Postn	UTSW	3	54376047	missense	probably null	0.99
RF018:Postn	UTSW	3	54384492	missense	probably damaging	0.96
X0004:Postn	UTSW	3	54362694	missense	probably damaging	1.00
X0022:Postn	UTSW	3	54370840	missense	probably benign	0.03
Z1088:Postn	UTSW	3	54375127	missense	probably benign	0.32

Predicted Primers

PCR Primer
(F):5'- CCCCAGCTCTCATGAAGTAC -3'
(R):5'- ATACTAGATGCTGGGCCAAGGTC -3'

Sequencing Primer
(F):5'- TAAATACCCTCCAGTGCTCTGAGG -3'
(R):5'- AAGGTCCTGCATGGGCTG -3'

Posted On

2017-08-16