Incidental Mutation 'R6101:Fblim1'
ID485244
Institutional Source Beutler Lab
Gene Symbol Fblim1
Ensembl Gene ENSMUSG00000006219
Gene Namefilamin binding LIM protein 1
Synonyms
MMRRC Submission 044251-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6101 (G1)
Quality Score221.009
Status Not validated
Chromosome4
Chromosomal Location141576062-141606096 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 141584722 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 231 (R231C)
Ref Sequence ENSEMBL: ENSMUSP00000101411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006381] [ENSMUST00000105784] [ENSMUST00000105785] [ENSMUST00000130181] [ENSMUST00000141518] [ENSMUST00000147764] [ENSMUST00000153189]
Predicted Effect probably damaging
Transcript: ENSMUST00000006381
AA Change: R231C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006381
Gene: ENSMUSG00000006219
AA Change: R231C

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 3e-7 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
LIM 184 237 6e-18 SMART
LIM 244 296 2.98e-13 SMART
LIM 304 365 3.32e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105784
AA Change: R231C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101410
Gene: ENSMUSG00000006219
AA Change: R231C

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 3e-7 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
LIM 184 237 6e-18 SMART
LIM 244 296 2.98e-13 SMART
LIM 304 365 3.32e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105785
AA Change: R231C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101411
Gene: ENSMUSG00000006219
AA Change: R231C

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 3e-7 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
LIM 184 237 6e-18 SMART
LIM 244 296 2.98e-13 SMART
LIM 304 365 3.32e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130181
SMART Domains Protein: ENSMUSP00000115992
Gene: ENSMUSG00000006219

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 1e-8 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 162 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141518
SMART Domains Protein: ENSMUSP00000123669
Gene: ENSMUSG00000006219

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 1e-8 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147764
SMART Domains Protein: ENSMUSP00000120600
Gene: ENSMUSG00000006219

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 1e-8 PDB
low complexity region 86 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153189
SMART Domains Protein: ENSMUSP00000123322
Gene: ENSMUSG00000006219

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 1e-8 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 162 172 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal filamin-binding domain, a central proline-rich domain, and, multiple C-terminal LIM domains. This protein localizes at cell junctions and may link cell adhesion structures to the actin cytoskeleton. This protein may be involved in the assembly and stabilization of actin-filaments and likely plays a role in modulating cell adhesion, cell morphology and cell motility. This protein also localizes to the nucleus and may affect cardiomyocyte differentiation after binding with the CSX/NKX2-5 transcription factor. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit severe osteopenia with decreased osteoblasts and increased osteoclasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,970,759 C570S probably damaging Het
Adh6b T A 3: 138,357,710 I350K possibly damaging Het
Ahnak G A 19: 9,004,099 V916I probably benign Het
Aldh4a1 C T 4: 139,638,495 P266S possibly damaging Het
Arhgap11a G A 2: 113,834,874 R460* probably null Het
Chl1 A T 6: 103,693,032 D477V probably damaging Het
Clstn3 A T 6: 124,461,670 L45Q probably damaging Het
Cnot7 C T 8: 40,510,037 R32Q probably benign Het
Csrnp1 T C 9: 119,973,485 D220G probably damaging Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Glul T A 1: 153,906,431 Y137* probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Igha T A 12: 113,256,397 probably benign Het
Kif2b A G 11: 91,575,988 S490P probably benign Het
Kxd1 A T 8: 70,519,939 N33K probably benign Het
Lrrk2 T C 15: 91,723,135 I567T probably benign Het
Man2a2 T C 7: 80,367,001 D355G probably damaging Het
Map6 T C 7: 99,268,107 V29A probably damaging Het
Mical3 A T 6: 121,033,710 V437D probably damaging Het
Mief1 T C 15: 80,249,740 Y333H probably benign Het
Olfr1303 A G 2: 111,814,253 F158L probably benign Het
Olfr533 T A 7: 140,466,519 V106D probably benign Het
Olfr917 A G 9: 38,665,620 S75P probably damaging Het
Olfr926 T C 9: 38,877,308 L44P possibly damaging Het
Pak1ip1 T A 13: 41,004,885 L78Q probably damaging Het
Pikfyve A G 1: 65,264,345 probably null Het
Pinlyp C T 7: 24,545,980 R5K possibly damaging Het
Pkd1l3 A G 8: 109,640,846 D1225G probably damaging Het
Pnmal2 T A 7: 16,946,568 S492R probably benign Het
Postn A G 3: 54,372,220 probably null Het
Ptprq A G 10: 107,580,266 Y1724H possibly damaging Het
Rpn2 T A 2: 157,310,188 probably null Het
Scn5a A G 9: 119,522,650 V755A probably damaging Het
Slc22a30 T C 19: 8,337,868 probably null Het
Specc1l T C 10: 75,248,632 S730P probably damaging Het
Steap2 T A 5: 5,675,891 I378F possibly damaging Het
Tdrd12 A T 7: 35,481,133 Y818* probably null Het
Thbs4 G T 13: 92,775,485 Q246K possibly damaging Het
Tnfsf10 A G 3: 27,335,549 Y253C probably damaging Het
Tnpo3 G T 6: 29,588,043 C125* probably null Het
Trim58 A G 11: 58,651,615 N467S probably benign Het
Trpm6 C T 19: 18,853,748 R1326* probably null Het
Zc3hav1l A G 6: 38,293,077 V279A probably benign Het
Zfp618 A T 4: 63,133,241 Q753L probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zkscan17 A T 11: 59,503,575 C67S probably damaging Het
Other mutations in Fblim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02634:Fblim1 APN 4 141583111 missense probably benign 0.43
IGL03036:Fblim1 APN 4 141583124 missense possibly damaging 0.65
IGL02802:Fblim1 UTSW 4 141590120 missense possibly damaging 0.90
PIT4377001:Fblim1 UTSW 4 141595409 missense probably damaging 1.00
R0840:Fblim1 UTSW 4 141581009 missense possibly damaging 0.88
R1793:Fblim1 UTSW 4 141595238 missense probably damaging 1.00
R1975:Fblim1 UTSW 4 141584864 missense probably damaging 1.00
R4829:Fblim1 UTSW 4 141584709 missense probably damaging 1.00
R6066:Fblim1 UTSW 4 141577909 missense probably damaging 1.00
R6126:Fblim1 UTSW 4 141584722 missense probably damaging 1.00
R6127:Fblim1 UTSW 4 141584722 missense probably damaging 1.00
R6128:Fblim1 UTSW 4 141584722 missense probably damaging 1.00
R7525:Fblim1 UTSW 4 141590080 missense probably damaging 1.00
Z1176:Fblim1 UTSW 4 141595371 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AACTAATCCTGCTTGGTTGAGTTTG -3'
(R):5'- TCAGTTGAGGAAGCCTTTGAGG -3'

Sequencing Primer
(F):5'- GAGTTTGCTCCTTTCTGAGTCTCAG -3'
(R):5'- TGCACACACTGGGGGATTG -3'
Posted On2017-08-16