Incidental Mutation 'R6101:Steap2'
ID485245
Institutional Source Beutler Lab
Gene Symbol Steap2
Ensembl Gene ENSMUSG00000015653
Gene Namesix transmembrane epithelial antigen of prostate 2
Synonyms
MMRRC Submission 044251-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6101 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location5664829-5694578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5675891 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 378 (I378F)
Ref Sequence ENSEMBL: ENSMUSP00000132501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015797] [ENSMUST00000115424] [ENSMUST00000115425] [ENSMUST00000115426] [ENSMUST00000115427] [ENSMUST00000148333] [ENSMUST00000164219]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015797
AA Change: I378F

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000015797
Gene: ENSMUSG00000015653
AA Change: I378F

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 8.9e-19 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 405 2.8e-16 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115424
AA Change: I378F

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111084
Gene: ENSMUSG00000015653
AA Change: I378F

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115425
AA Change: I378F

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111085
Gene: ENSMUSG00000015653
AA Change: I378F

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115426
AA Change: I378F

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111086
Gene: ENSMUSG00000015653
AA Change: I378F

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115427
AA Change: I378F

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111087
Gene: ENSMUSG00000015653
AA Change: I378F

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 2.3e-17 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 401 1.8e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000148333
AA Change: I378F

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116910
Gene: ENSMUSG00000015653
AA Change: I378F

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 8.3e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 2.7e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150238
Predicted Effect possibly damaging
Transcript: ENSMUST00000164219
AA Change: I378F

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132501
Gene: ENSMUSG00000015653
AA Change: I378F

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the STEAP family and encodes a multi-pass membrane protein that localizes to the Golgi complex, the plasma membrane, and the vesicular tubular structures in the cytosol. A highly similar protein in mouse has both ferrireductase and cupric reductase activity, and stimulates the cellular uptake of both iron and copper in vitro. Increased transcriptional expression of the human gene is associated with prostate cancer progression. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,970,759 C570S probably damaging Het
Adh6b T A 3: 138,357,710 I350K possibly damaging Het
Ahnak G A 19: 9,004,099 V916I probably benign Het
Aldh4a1 C T 4: 139,638,495 P266S possibly damaging Het
Arhgap11a G A 2: 113,834,874 R460* probably null Het
Chl1 A T 6: 103,693,032 D477V probably damaging Het
Clstn3 A T 6: 124,461,670 L45Q probably damaging Het
Cnot7 C T 8: 40,510,037 R32Q probably benign Het
Csrnp1 T C 9: 119,973,485 D220G probably damaging Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Glul T A 1: 153,906,431 Y137* probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Igha T A 12: 113,256,397 probably benign Het
Kif2b A G 11: 91,575,988 S490P probably benign Het
Kxd1 A T 8: 70,519,939 N33K probably benign Het
Lrrk2 T C 15: 91,723,135 I567T probably benign Het
Man2a2 T C 7: 80,367,001 D355G probably damaging Het
Map6 T C 7: 99,268,107 V29A probably damaging Het
Mical3 A T 6: 121,033,710 V437D probably damaging Het
Mief1 T C 15: 80,249,740 Y333H probably benign Het
Olfr1303 A G 2: 111,814,253 F158L probably benign Het
Olfr533 T A 7: 140,466,519 V106D probably benign Het
Olfr917 A G 9: 38,665,620 S75P probably damaging Het
Olfr926 T C 9: 38,877,308 L44P possibly damaging Het
Pak1ip1 T A 13: 41,004,885 L78Q probably damaging Het
Pikfyve A G 1: 65,264,345 probably null Het
Pinlyp C T 7: 24,545,980 R5K possibly damaging Het
Pkd1l3 A G 8: 109,640,846 D1225G probably damaging Het
Pnmal2 T A 7: 16,946,568 S492R probably benign Het
Postn A G 3: 54,372,220 probably null Het
Ptprq A G 10: 107,580,266 Y1724H possibly damaging Het
Rpn2 T A 2: 157,310,188 probably null Het
Scn5a A G 9: 119,522,650 V755A probably damaging Het
Slc22a30 T C 19: 8,337,868 probably null Het
Specc1l T C 10: 75,248,632 S730P probably damaging Het
Tdrd12 A T 7: 35,481,133 Y818* probably null Het
Thbs4 G T 13: 92,775,485 Q246K possibly damaging Het
Tnfsf10 A G 3: 27,335,549 Y253C probably damaging Het
Tnpo3 G T 6: 29,588,043 C125* probably null Het
Trim58 A G 11: 58,651,615 N467S probably benign Het
Trpm6 C T 19: 18,853,748 R1326* probably null Het
Zc3hav1l A G 6: 38,293,077 V279A probably benign Het
Zfp618 A T 4: 63,133,241 Q753L probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zkscan17 A T 11: 59,503,575 C67S probably damaging Het
Other mutations in Steap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Steap2 APN 5 5673586 missense probably damaging 0.99
IGL02272:Steap2 APN 5 5677612 missense probably benign 0.10
IGL02680:Steap2 APN 5 5673474 missense probably benign 0.00
R0267:Steap2 UTSW 5 5673561 missense probably benign 0.00
R1670:Steap2 UTSW 5 5677393 missense possibly damaging 0.80
R2175:Steap2 UTSW 5 5673501 missense probably damaging 1.00
R2188:Steap2 UTSW 5 5673643 nonsense probably null
R2374:Steap2 UTSW 5 5675845 missense probably damaging 0.99
R4902:Steap2 UTSW 5 5675866 missense possibly damaging 0.91
R4941:Steap2 UTSW 5 5677651 missense probably damaging 1.00
R5012:Steap2 UTSW 5 5677784 missense possibly damaging 0.48
R5555:Steap2 UTSW 5 5677544 missense possibly damaging 0.89
R5571:Steap2 UTSW 5 5675912 missense probably damaging 1.00
R5666:Steap2 UTSW 5 5673681 missense probably benign 0.00
R5670:Steap2 UTSW 5 5673681 missense probably benign 0.00
R5677:Steap2 UTSW 5 5677497 nonsense probably null
R6105:Steap2 UTSW 5 5675891 missense possibly damaging 0.71
R6190:Steap2 UTSW 5 5675881 missense probably damaging 1.00
R7172:Steap2 UTSW 5 5682896 missense possibly damaging 0.52
R7576:Steap2 UTSW 5 5677406 missense probably benign 0.01
R7706:Steap2 UTSW 5 5682967 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGCCTTTCACTTACTAAACTGG -3'
(R):5'- TGAGAGTACGTGATGTGCAG -3'

Sequencing Primer
(F):5'- CTAAACTGGCCTTTAGGTACATGTG -3'
(R):5'- GTGCAGAGTCAGCGAACATTCTAC -3'
Posted On2017-08-16