Incidental Mutation 'R6101:Zc3hav1l'
ID485247
Institutional Source Beutler Lab
Gene Symbol Zc3hav1l
Ensembl Gene ENSMUSG00000047749
Gene Namezinc finger CCCH-type, antiviral 1-like
SynonymsE430016P22Rik, B130055L09Rik
MMRRC Submission 044251-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6101 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location38287396-38299259 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38293077 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 279 (V279A)
Ref Sequence ENSEMBL: ENSMUSP00000062475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058524]
Predicted Effect probably benign
Transcript: ENSMUST00000058524
AA Change: V279A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062475
Gene: ENSMUSG00000047749
AA Change: V279A

DomainStartEndE-ValueType
low complexity region 63 81 N/A INTRINSIC
internal_repeat_1 106 133 4.92e-5 PROSPERO
internal_repeat_1 193 220 4.92e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,970,759 C570S probably damaging Het
Adh6b T A 3: 138,357,710 I350K possibly damaging Het
Ahnak G A 19: 9,004,099 V916I probably benign Het
Aldh4a1 C T 4: 139,638,495 P266S possibly damaging Het
Arhgap11a G A 2: 113,834,874 R460* probably null Het
Chl1 A T 6: 103,693,032 D477V probably damaging Het
Clstn3 A T 6: 124,461,670 L45Q probably damaging Het
Cnot7 C T 8: 40,510,037 R32Q probably benign Het
Csrnp1 T C 9: 119,973,485 D220G probably damaging Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Glul T A 1: 153,906,431 Y137* probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Igha T A 12: 113,256,397 probably benign Het
Kif2b A G 11: 91,575,988 S490P probably benign Het
Kxd1 A T 8: 70,519,939 N33K probably benign Het
Lrrk2 T C 15: 91,723,135 I567T probably benign Het
Man2a2 T C 7: 80,367,001 D355G probably damaging Het
Map6 T C 7: 99,268,107 V29A probably damaging Het
Mical3 A T 6: 121,033,710 V437D probably damaging Het
Mief1 T C 15: 80,249,740 Y333H probably benign Het
Olfr1303 A G 2: 111,814,253 F158L probably benign Het
Olfr533 T A 7: 140,466,519 V106D probably benign Het
Olfr917 A G 9: 38,665,620 S75P probably damaging Het
Olfr926 T C 9: 38,877,308 L44P possibly damaging Het
Pak1ip1 T A 13: 41,004,885 L78Q probably damaging Het
Pikfyve A G 1: 65,264,345 probably null Het
Pinlyp C T 7: 24,545,980 R5K possibly damaging Het
Pkd1l3 A G 8: 109,640,846 D1225G probably damaging Het
Pnmal2 T A 7: 16,946,568 S492R probably benign Het
Postn A G 3: 54,372,220 probably null Het
Ptprq A G 10: 107,580,266 Y1724H possibly damaging Het
Rpn2 T A 2: 157,310,188 probably null Het
Scn5a A G 9: 119,522,650 V755A probably damaging Het
Slc22a30 T C 19: 8,337,868 probably null Het
Specc1l T C 10: 75,248,632 S730P probably damaging Het
Steap2 T A 5: 5,675,891 I378F possibly damaging Het
Tdrd12 A T 7: 35,481,133 Y818* probably null Het
Thbs4 G T 13: 92,775,485 Q246K possibly damaging Het
Tnfsf10 A G 3: 27,335,549 Y253C probably damaging Het
Tnpo3 G T 6: 29,588,043 C125* probably null Het
Trim58 A G 11: 58,651,615 N467S probably benign Het
Trpm6 C T 19: 18,853,748 R1326* probably null Het
Zfp618 A T 4: 63,133,241 Q753L probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zkscan17 A T 11: 59,503,575 C67S probably damaging Het
Other mutations in Zc3hav1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0070:Zc3hav1l UTSW 6 38295190 missense probably damaging 1.00
R0070:Zc3hav1l UTSW 6 38295190 missense probably damaging 1.00
R1833:Zc3hav1l UTSW 6 38297946 splice site probably benign
R3718:Zc3hav1l UTSW 6 38295125 missense probably damaging 1.00
R6034:Zc3hav1l UTSW 6 38295280 missense probably damaging 1.00
R6034:Zc3hav1l UTSW 6 38295280 missense probably damaging 1.00
R6105:Zc3hav1l UTSW 6 38293077 missense probably benign
R7315:Zc3hav1l UTSW 6 38295147 missense possibly damaging 0.94
R7352:Zc3hav1l UTSW 6 38298981 missense probably benign 0.03
R8021:Zc3hav1l UTSW 6 38297947 splice site probably benign
Predicted Primers PCR Primer
(F):5'- TCCTGGCGATCAGTTAGTTG -3'
(R):5'- CAGAAACATCTCCTCAAGTTGC -3'

Sequencing Primer
(F):5'- AGGTAGGTATTACAGTTGCCAATG -3'
(R):5'- CATGTTGCTTCCAACAACG -3'
Posted On2017-08-16