Incidental Mutation 'R6101:Chl1'
ID485248
Institutional Source Beutler Lab
Gene Symbol Chl1
Ensembl Gene ENSMUSG00000030077
Gene Namecell adhesion molecule L1-like
SynonymsA530023M13Rik, LICAM2, close homolog of L1, CALL
MMRRC Submission 044251-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.605) question?
Stock #R6101 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location103510586-103750211 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103693032 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 477 (D477V)
Ref Sequence ENSEMBL: ENSMUSP00000145026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066905] [ENSMUST00000203830] [ENSMUST00000203912] [ENSMUST00000205098]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066905
AA Change: D461V

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000063933
Gene: ENSMUSG00000030077
AA Change: D461V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 253 317 3.76e-17 SMART
IGc2 343 408 1.61e-7 SMART
IGc2 436 501 1.56e-5 SMART
IG 521 609 6.02e-7 SMART
IG_like 539 598 1.27e-1 SMART
FN3 612 695 2.24e-13 SMART
FN3 712 794 1.92e-3 SMART
FN3 810 901 2.3e-1 SMART
FN3 916 1002 4.09e-7 SMART
transmembrane domain 1082 1104 N/A INTRINSIC
Pfam:Bravo_FIGEY 1105 1190 3.9e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203830
AA Change: D461V

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144758
Gene: ENSMUSG00000030077
AA Change: D461V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 253 317 3.76e-17 SMART
IGc2 343 408 1.61e-7 SMART
IGc2 436 501 1.56e-5 SMART
IG 521 609 6.02e-7 SMART
IG_like 539 598 1.27e-1 SMART
FN3 612 695 2.24e-13 SMART
FN3 712 794 1.92e-3 SMART
FN3 810 901 2.3e-1 SMART
FN3 916 1002 4.09e-7 SMART
transmembrane domain 1082 1104 N/A INTRINSIC
Pfam:Bravo_FIGEY 1105 1190 3.9e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203912
AA Change: D477V

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145026
Gene: ENSMUSG00000030077
AA Change: D477V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 269 333 3.76e-17 SMART
IGc2 359 424 1.61e-7 SMART
IGc2 452 517 1.56e-5 SMART
IG 537 625 6.02e-7 SMART
IG_like 555 614 1.27e-1 SMART
FN3 628 711 2.24e-13 SMART
FN3 728 810 1.92e-3 SMART
FN3 826 917 2.3e-1 SMART
FN3 932 1018 4.09e-7 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Bravo_FIGEY 1067 1131 2.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205098
SMART Domains Protein: ENSMUSP00000144739
Gene: ENSMUSG00000030077

DomainStartEndE-ValueType
FN3 4 67 4.4e-1 SMART
FN3 83 174 1.2e-3 SMART
FN3 189 275 2.1e-9 SMART
transmembrane domain 301 323 N/A INTRINSIC
Pfam:Bravo_FIGEY 324 409 3.6e-30 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the L1 gene family of neural cell adhesion molecules. It is a neural recognition molecule that may be involved in signal transduction pathways. The deletion of one copy of this gene may be responsible for mental defects in patients with 3p- syndrome. This protein may also play a role in the growth of certain cancers. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in enlargement of the lateral ventricles and altered hippocampal mossy fiber organization. Mutant animals exhibit altered exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,970,759 C570S probably damaging Het
Adh6b T A 3: 138,357,710 I350K possibly damaging Het
Ahnak G A 19: 9,004,099 V916I probably benign Het
Aldh4a1 C T 4: 139,638,495 P266S possibly damaging Het
Arhgap11a G A 2: 113,834,874 R460* probably null Het
Clstn3 A T 6: 124,461,670 L45Q probably damaging Het
Cnot7 C T 8: 40,510,037 R32Q probably benign Het
Csrnp1 T C 9: 119,973,485 D220G probably damaging Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Glul T A 1: 153,906,431 Y137* probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Igha T A 12: 113,256,397 probably benign Het
Kif2b A G 11: 91,575,988 S490P probably benign Het
Kxd1 A T 8: 70,519,939 N33K probably benign Het
Lrrk2 T C 15: 91,723,135 I567T probably benign Het
Man2a2 T C 7: 80,367,001 D355G probably damaging Het
Map6 T C 7: 99,268,107 V29A probably damaging Het
Mical3 A T 6: 121,033,710 V437D probably damaging Het
Mief1 T C 15: 80,249,740 Y333H probably benign Het
Olfr1303 A G 2: 111,814,253 F158L probably benign Het
Olfr533 T A 7: 140,466,519 V106D probably benign Het
Olfr917 A G 9: 38,665,620 S75P probably damaging Het
Olfr926 T C 9: 38,877,308 L44P possibly damaging Het
Pak1ip1 T A 13: 41,004,885 L78Q probably damaging Het
Pikfyve A G 1: 65,264,345 probably null Het
Pinlyp C T 7: 24,545,980 R5K possibly damaging Het
Pkd1l3 A G 8: 109,640,846 D1225G probably damaging Het
Pnmal2 T A 7: 16,946,568 S492R probably benign Het
Postn A G 3: 54,372,220 probably null Het
Ptprq A G 10: 107,580,266 Y1724H possibly damaging Het
Rpn2 T A 2: 157,310,188 probably null Het
Scn5a A G 9: 119,522,650 V755A probably damaging Het
Slc22a30 T C 19: 8,337,868 probably null Het
Specc1l T C 10: 75,248,632 S730P probably damaging Het
Steap2 T A 5: 5,675,891 I378F possibly damaging Het
Tdrd12 A T 7: 35,481,133 Y818* probably null Het
Thbs4 G T 13: 92,775,485 Q246K possibly damaging Het
Tnfsf10 A G 3: 27,335,549 Y253C probably damaging Het
Tnpo3 G T 6: 29,588,043 C125* probably null Het
Trim58 A G 11: 58,651,615 N467S probably benign Het
Trpm6 C T 19: 18,853,748 R1326* probably null Het
Zc3hav1l A G 6: 38,293,077 V279A probably benign Het
Zfp618 A T 4: 63,133,241 Q753L probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zkscan17 A T 11: 59,503,575 C67S probably damaging Het
Other mutations in Chl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Chl1 APN 6 103693061 missense probably benign 0.08
IGL00786:Chl1 APN 6 103675145 missense probably damaging 1.00
IGL00959:Chl1 APN 6 103709250 splice site probably null
IGL01109:Chl1 APN 6 103715393 missense probably damaging 1.00
IGL01354:Chl1 APN 6 103665853 missense probably benign 0.01
IGL01367:Chl1 APN 6 103729225 missense probably benign 0.42
IGL01371:Chl1 APN 6 103715364 missense probably damaging 1.00
IGL01599:Chl1 APN 6 103708484 missense probably benign 0.34
IGL01724:Chl1 APN 6 103649573 missense probably damaging 1.00
IGL02001:Chl1 APN 6 103642056 missense possibly damaging 0.90
IGL02066:Chl1 APN 6 103698224 missense probably benign 0.39
IGL02122:Chl1 APN 6 103675137 missense probably benign 0.39
IGL02340:Chl1 APN 6 103698125 missense probably damaging 1.00
IGL02420:Chl1 APN 6 103715369 missense probably damaging 1.00
IGL02421:Chl1 APN 6 103717580 missense probably damaging 1.00
IGL02429:Chl1 APN 6 103664809 unclassified probably benign
IGL02825:Chl1 APN 6 103668803 missense possibly damaging 0.87
IGL02858:Chl1 APN 6 103641988 missense probably damaging 1.00
IGL03169:Chl1 APN 6 103665967 missense probably damaging 1.00
IGL03185:Chl1 APN 6 103665863 missense probably damaging 1.00
IGL03189:Chl1 APN 6 103683207 missense possibly damaging 0.91
IGL03288:Chl1 APN 6 103675097 missense probably damaging 1.00
IGL03404:Chl1 APN 6 103693091 missense probably damaging 1.00
IGL03052:Chl1 UTSW 6 103691667 missense probably benign 0.01
R0060:Chl1 UTSW 6 103711058 splice site probably benign
R0060:Chl1 UTSW 6 103711058 splice site probably benign
R0062:Chl1 UTSW 6 103749652 missense unknown
R0314:Chl1 UTSW 6 103647301 missense probably damaging 1.00
R0322:Chl1 UTSW 6 103701883 splice site probably benign
R0685:Chl1 UTSW 6 103708542 splice site probably null
R0702:Chl1 UTSW 6 103706622 missense probably damaging 1.00
R1056:Chl1 UTSW 6 103675077 missense possibly damaging 0.66
R1138:Chl1 UTSW 6 103693179 missense probably benign 0.05
R1483:Chl1 UTSW 6 103647287 missense probably damaging 1.00
R1571:Chl1 UTSW 6 103708484 missense probably benign 0.34
R1620:Chl1 UTSW 6 103690242 missense probably benign 0.00
R1645:Chl1 UTSW 6 103683180 missense probably benign 0.06
R1773:Chl1 UTSW 6 103647331 critical splice donor site probably null
R1852:Chl1 UTSW 6 103699159 utr 5 prime probably null
R1891:Chl1 UTSW 6 103714583 missense possibly damaging 0.88
R2146:Chl1 UTSW 6 103715401 critical splice donor site probably null
R2147:Chl1 UTSW 6 103715401 critical splice donor site probably null
R2148:Chl1 UTSW 6 103715401 critical splice donor site probably null
R2163:Chl1 UTSW 6 103711231 missense probably damaging 1.00
R2291:Chl1 UTSW 6 103715393 missense probably damaging 1.00
R2920:Chl1 UTSW 6 103695343 missense probably damaging 1.00
R3611:Chl1 UTSW 6 103698155 missense probably damaging 1.00
R3979:Chl1 UTSW 6 103715284 nonsense probably null
R4987:Chl1 UTSW 6 103674977 missense probably damaging 1.00
R5266:Chl1 UTSW 6 103700543 missense probably damaging 1.00
R5478:Chl1 UTSW 6 103683221 missense probably damaging 1.00
R5523:Chl1 UTSW 6 103708714 missense probably damaging 1.00
R5887:Chl1 UTSW 6 103717604 missense probably benign 0.00
R5986:Chl1 UTSW 6 103709191 missense probably benign 0.45
R6179:Chl1 UTSW 6 103683243 missense probably benign 0.38
R6366:Chl1 UTSW 6 103729236 missense possibly damaging 0.95
R6634:Chl1 UTSW 6 103690259 missense probably damaging 1.00
R6824:Chl1 UTSW 6 103714549 missense probably damaging 1.00
R6913:Chl1 UTSW 6 103665948 nonsense probably null
R7097:Chl1 UTSW 6 103706448 missense probably damaging 1.00
R7122:Chl1 UTSW 6 103706448 missense probably damaging 1.00
R7198:Chl1 UTSW 6 103706556 missense probably damaging 1.00
R7203:Chl1 UTSW 6 103691674 missense probably benign 0.13
R7527:Chl1 UTSW 6 103711201 missense probably damaging 1.00
R7625:Chl1 UTSW 6 103729125 missense probably damaging 1.00
R7667:Chl1 UTSW 6 103695495 missense possibly damaging 0.82
R7683:Chl1 UTSW 6 103691652 missense possibly damaging 0.72
R7712:Chl1 UTSW 6 103711102 missense possibly damaging 0.94
R7838:Chl1 UTSW 6 103691674 missense probably benign 0.01
R7863:Chl1 UTSW 6 103706514 missense possibly damaging 0.46
R7874:Chl1 UTSW 6 103690263 missense probably benign 0.22
R7998:Chl1 UTSW 6 103729289 missense probably benign 0.01
R8044:Chl1 UTSW 6 103706632 missense probably damaging 0.96
R8059:Chl1 UTSW 6 103674987 missense probably damaging 0.97
Z1177:Chl1 UTSW 6 103693096 nonsense probably null
Z1177:Chl1 UTSW 6 103697949 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTAGCTATAGTCTGTTGGCCAGC -3'
(R):5'- TGGACCCCTATGAGAAACCC -3'

Sequencing Primer
(F):5'- TTGGCCAGCTCTGATGGAC -3'
(R):5'- GGACCCCTATGAGAAACCCTGAAAG -3'
Posted On2017-08-16