Incidental Mutation 'R6101:Adam9'
ID485257
Institutional Source Beutler Lab
Gene Symbol Adam9
Ensembl Gene ENSMUSG00000031555
Gene Namea disintegrin and metallopeptidase domain 9 (meltrin gamma)
SynonymsMDC9, MDC9, Mltng, Mltng
MMRRC Submission 044251-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6101 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location24949611-25016927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24970759 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 570 (C570S)
Ref Sequence ENSEMBL: ENSMUSP00000146545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084032] [ENSMUST00000084035] [ENSMUST00000208247]
Predicted Effect probably damaging
Transcript: ENSMUST00000084032
AA Change: C570S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081045
Gene: ENSMUSG00000031555
AA Change: C570S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 163 8.5e-36 PFAM
Pfam:Reprolysin_5 210 386 5.5e-20 PFAM
Pfam:Reprolysin_4 210 402 1.4e-11 PFAM
Pfam:Reprolysin 212 406 1e-67 PFAM
Pfam:Reprolysin_2 232 396 1.1e-12 PFAM
Pfam:Reprolysin_3 236 358 8.1e-19 PFAM
DISIN 423 499 8.7e-44 SMART
ACR 500 637 9.7e-75 SMART
EGF 643 674 9.9e-2 SMART
transmembrane domain 699 718 N/A INTRINSIC
low complexity region 753 787 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084035
AA Change: C570S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081048
Gene: ENSMUSG00000031555
AA Change: C570S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Pep_M12B_propep 34 163 8.1e-31 PFAM
Pfam:Reprolysin_5 210 386 5.8e-22 PFAM
Pfam:Reprolysin_4 210 402 1.6e-13 PFAM
Pfam:Reprolysin 212 406 1.9e-73 PFAM
Pfam:Reprolysin_2 232 396 9.4e-15 PFAM
Pfam:Reprolysin_3 236 358 3.4e-19 PFAM
DISIN 423 499 1.71e-41 SMART
ACR 500 637 2.86e-72 SMART
EGF 643 674 2.03e1 SMART
transmembrane domain 699 718 N/A INTRINSIC
low complexity region 753 794 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 831 839 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000208247
AA Change: C570S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene interacts with SH3 domain-containing proteins, binds mitotic arrest deficient 2 beta protein, and is also involved in TPA-induced ectodomain shedding of membrane-anchored heparin-binding EGF-like growth factor. Several alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous knockout mice exhibit progressive retinal degeneration, disorganized retinal layers and a degenerate retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh6b T A 3: 138,357,710 I350K possibly damaging Het
Ahnak G A 19: 9,004,099 V916I probably benign Het
Aldh4a1 C T 4: 139,638,495 P266S possibly damaging Het
Arhgap11a G A 2: 113,834,874 R460* probably null Het
Chl1 A T 6: 103,693,032 D477V probably damaging Het
Clstn3 A T 6: 124,461,670 L45Q probably damaging Het
Cnot7 C T 8: 40,510,037 R32Q probably benign Het
Csrnp1 T C 9: 119,973,485 D220G probably damaging Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Glul T A 1: 153,906,431 Y137* probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Igha T A 12: 113,256,397 probably benign Het
Kif2b A G 11: 91,575,988 S490P probably benign Het
Kxd1 A T 8: 70,519,939 N33K probably benign Het
Lrrk2 T C 15: 91,723,135 I567T probably benign Het
Man2a2 T C 7: 80,367,001 D355G probably damaging Het
Map6 T C 7: 99,268,107 V29A probably damaging Het
Mical3 A T 6: 121,033,710 V437D probably damaging Het
Mief1 T C 15: 80,249,740 Y333H probably benign Het
Olfr1303 A G 2: 111,814,253 F158L probably benign Het
Olfr533 T A 7: 140,466,519 V106D probably benign Het
Olfr917 A G 9: 38,665,620 S75P probably damaging Het
Olfr926 T C 9: 38,877,308 L44P possibly damaging Het
Pak1ip1 T A 13: 41,004,885 L78Q probably damaging Het
Pikfyve A G 1: 65,264,345 probably null Het
Pinlyp C T 7: 24,545,980 R5K possibly damaging Het
Pkd1l3 A G 8: 109,640,846 D1225G probably damaging Het
Pnmal2 T A 7: 16,946,568 S492R probably benign Het
Postn A G 3: 54,372,220 probably null Het
Ptprq A G 10: 107,580,266 Y1724H possibly damaging Het
Rpn2 T A 2: 157,310,188 probably null Het
Scn5a A G 9: 119,522,650 V755A probably damaging Het
Slc22a30 T C 19: 8,337,868 probably null Het
Specc1l T C 10: 75,248,632 S730P probably damaging Het
Steap2 T A 5: 5,675,891 I378F possibly damaging Het
Tdrd12 A T 7: 35,481,133 Y818* probably null Het
Thbs4 G T 13: 92,775,485 Q246K possibly damaging Het
Tnfsf10 A G 3: 27,335,549 Y253C probably damaging Het
Tnpo3 G T 6: 29,588,043 C125* probably null Het
Trim58 A G 11: 58,651,615 N467S probably benign Het
Trpm6 C T 19: 18,853,748 R1326* probably null Het
Zc3hav1l A G 6: 38,293,077 V279A probably benign Het
Zfp618 A T 4: 63,133,241 Q753L probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zkscan17 A T 11: 59,503,575 C67S probably damaging Het
Other mutations in Adam9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01611:Adam9 APN 8 24967196 missense probably benign 0.03
IGL01786:Adam9 APN 8 24996839 missense probably damaging 1.00
IGL02095:Adam9 APN 8 24996729 missense probably benign 0.00
IGL02322:Adam9 APN 8 24955974 missense probably damaging 1.00
IGL02555:Adam9 APN 8 24966736 missense probably damaging 1.00
IGL02869:Adam9 APN 8 24970618 missense probably damaging 1.00
R0126:Adam9 UTSW 8 24970737 missense probably damaging 1.00
R0448:Adam9 UTSW 8 24964910 missense probably damaging 1.00
R0552:Adam9 UTSW 8 24963010 missense probably benign 0.00
R0730:Adam9 UTSW 8 24996758 missense probably benign 0.02
R1455:Adam9 UTSW 8 24993109 missense probably benign 0.00
R1974:Adam9 UTSW 8 24992224 missense probably damaging 1.00
R2043:Adam9 UTSW 8 24996653 critical splice donor site probably null
R2054:Adam9 UTSW 8 24991294 missense probably damaging 1.00
R2091:Adam9 UTSW 8 24995184 splice site probably benign
R2111:Adam9 UTSW 8 24982126 splice site probably benign
R4261:Adam9 UTSW 8 24964907 nonsense probably null
R4852:Adam9 UTSW 8 25003301 missense probably damaging 1.00
R5165:Adam9 UTSW 8 24967174 missense possibly damaging 0.88
R6022:Adam9 UTSW 8 25003305 missense possibly damaging 0.87
R6105:Adam9 UTSW 8 24970759 missense probably damaging 1.00
R6415:Adam9 UTSW 8 24978482 missense probably damaging 1.00
R7241:Adam9 UTSW 8 24950986 missense possibly damaging 0.53
R7442:Adam9 UTSW 8 24967207 missense probably damaging 0.99
R7552:Adam9 UTSW 8 24955972 missense unknown
R8076:Adam9 UTSW 8 24962922 nonsense probably null
R8265:Adam9 UTSW 8 24967186 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGCCAGCATCACATTTG -3'
(R):5'- GAAACACTTTTGTACTGCTCGC -3'

Sequencing Primer
(F):5'- ACATTTGGTGCCTTCATTCAC -3'
(R):5'- ATCCCATCTGGTGACTGCGTG -3'
Posted On2017-08-16