Incidental Mutation 'R6101:Olfr917'
ID485261
Institutional Source Beutler Lab
Gene Symbol Olfr917
Ensembl Gene ENSMUSG00000063225
Gene Nameolfactory receptor 917
SynonymsGA_x6K02T2PVTD-32368166-32367237, MOR168-2P
MMRRC Submission 044251-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6101 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location38664913-38665842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38665620 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 75 (S75P)
Ref Sequence ENSEMBL: ENSMUSP00000075857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076542] [ENSMUST00000215461]
Predicted Effect probably damaging
Transcript: ENSMUST00000076542
AA Change: S75P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075857
Gene: ENSMUSG00000063225
AA Change: S75P

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.2e-42 PFAM
Pfam:7tm_1 41 289 3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213750
Predicted Effect probably benign
Transcript: ENSMUST00000215461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217596
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,970,759 C570S probably damaging Het
Adh6b T A 3: 138,357,710 I350K possibly damaging Het
Ahnak G A 19: 9,004,099 V916I probably benign Het
Aldh4a1 C T 4: 139,638,495 P266S possibly damaging Het
Arhgap11a G A 2: 113,834,874 R460* probably null Het
Chl1 A T 6: 103,693,032 D477V probably damaging Het
Clstn3 A T 6: 124,461,670 L45Q probably damaging Het
Cnot7 C T 8: 40,510,037 R32Q probably benign Het
Csrnp1 T C 9: 119,973,485 D220G probably damaging Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Glul T A 1: 153,906,431 Y137* probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Igha T A 12: 113,256,397 probably benign Het
Kif2b A G 11: 91,575,988 S490P probably benign Het
Kxd1 A T 8: 70,519,939 N33K probably benign Het
Lrrk2 T C 15: 91,723,135 I567T probably benign Het
Man2a2 T C 7: 80,367,001 D355G probably damaging Het
Map6 T C 7: 99,268,107 V29A probably damaging Het
Mical3 A T 6: 121,033,710 V437D probably damaging Het
Mief1 T C 15: 80,249,740 Y333H probably benign Het
Olfr1303 A G 2: 111,814,253 F158L probably benign Het
Olfr533 T A 7: 140,466,519 V106D probably benign Het
Olfr926 T C 9: 38,877,308 L44P possibly damaging Het
Pak1ip1 T A 13: 41,004,885 L78Q probably damaging Het
Pikfyve A G 1: 65,264,345 probably null Het
Pinlyp C T 7: 24,545,980 R5K possibly damaging Het
Pkd1l3 A G 8: 109,640,846 D1225G probably damaging Het
Pnmal2 T A 7: 16,946,568 S492R probably benign Het
Postn A G 3: 54,372,220 probably null Het
Ptprq A G 10: 107,580,266 Y1724H possibly damaging Het
Rpn2 T A 2: 157,310,188 probably null Het
Scn5a A G 9: 119,522,650 V755A probably damaging Het
Slc22a30 T C 19: 8,337,868 probably null Het
Specc1l T C 10: 75,248,632 S730P probably damaging Het
Steap2 T A 5: 5,675,891 I378F possibly damaging Het
Tdrd12 A T 7: 35,481,133 Y818* probably null Het
Thbs4 G T 13: 92,775,485 Q246K possibly damaging Het
Tnfsf10 A G 3: 27,335,549 Y253C probably damaging Het
Tnpo3 G T 6: 29,588,043 C125* probably null Het
Trim58 A G 11: 58,651,615 N467S probably benign Het
Trpm6 C T 19: 18,853,748 R1326* probably null Het
Zc3hav1l A G 6: 38,293,077 V279A probably benign Het
Zfp618 A T 4: 63,133,241 Q753L probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zkscan17 A T 11: 59,503,575 C67S probably damaging Het
Other mutations in Olfr917
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Olfr917 APN 9 38664993 missense probably benign
IGL02704:Olfr917 APN 9 38665767 missense possibly damaging 0.84
R0529:Olfr917 UTSW 9 38665512 missense probably benign 0.11
R1575:Olfr917 UTSW 9 38665277 missense probably damaging 1.00
R1681:Olfr917 UTSW 9 38665320 missense probably benign
R2941:Olfr917 UTSW 9 38665026 missense probably damaging 0.98
R3083:Olfr917 UTSW 9 38665616 missense probably damaging 0.99
R4450:Olfr917 UTSW 9 38665754 missense probably benign 0.17
R4755:Olfr917 UTSW 9 38665832 missense probably benign
R4774:Olfr917 UTSW 9 38665223 missense probably benign 0.21
R5322:Olfr917 UTSW 9 38665206 missense probably benign 0.24
R5577:Olfr917 UTSW 9 38665001 missense possibly damaging 0.49
R6105:Olfr917 UTSW 9 38665620 missense probably damaging 0.99
R7084:Olfr917 UTSW 9 38665269 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TAGGAAACAAGCATTAGGTTCAAGC -3'
(R):5'- CTGGTGGGATTAACTGACAAGC -3'

Sequencing Primer
(F):5'- GGTTCAAGCATAATTTAGAGGACATG -3'
(R):5'- GGTGGGATTAACTGACAAGCCTTATC -3'
Posted On2017-08-16