Incidental Mutation 'R6101:Csrnp1'
ID485264
Institutional Source Beutler Lab
Gene Symbol Csrnp1
Ensembl Gene ENSMUSG00000032515
Gene Namecysteine-serine-rich nuclear protein 1
Synonyms4931429D10Rik, taip-3, CSRNP-1, Axud1
MMRRC Submission 044251-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6101 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location119971163-119984658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119973485 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 220 (D220G)
Ref Sequence ENSEMBL: ENSMUSP00000149214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035101] [ENSMUST00000177637] [ENSMUST00000213936] [ENSMUST00000214058] [ENSMUST00000215916] [ENSMUST00000216929]
Predicted Effect probably damaging
Transcript: ENSMUST00000035101
AA Change: D220G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035101
Gene: ENSMUSG00000032515
AA Change: D220G

DomainStartEndE-ValueType
low complexity region 17 41 N/A INTRINSIC
Pfam:CSRNP_N 79 304 1.6e-93 PFAM
low complexity region 327 361 N/A INTRINSIC
low complexity region 398 410 N/A INTRINSIC
low complexity region 463 482 N/A INTRINSIC
low complexity region 487 499 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213936
Predicted Effect probably damaging
Transcript: ENSMUST00000214058
AA Change: D220G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000215916
AA Change: D220G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000216929
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that localizes to the nucleus and expression of this gene is induced in response to elevated levels of axin. The Wnt signalling pathway, which is negatively regulated by axin, is important in axis formation in early development and impaired regulation of this signalling pathway is often involved in tumors. A decreased level of expression of this gene in tumors compared to the level of expression in their corresponding normal tissues suggests that this gene product has a tumor suppressor function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal lethality and skeletal and craniofacial defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,970,759 C570S probably damaging Het
Adh6b T A 3: 138,357,710 I350K possibly damaging Het
Ahnak G A 19: 9,004,099 V916I probably benign Het
Aldh4a1 C T 4: 139,638,495 P266S possibly damaging Het
Arhgap11a G A 2: 113,834,874 R460* probably null Het
Chl1 A T 6: 103,693,032 D477V probably damaging Het
Clstn3 A T 6: 124,461,670 L45Q probably damaging Het
Cnot7 C T 8: 40,510,037 R32Q probably benign Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Glul T A 1: 153,906,431 Y137* probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Igha T A 12: 113,256,397 probably benign Het
Kif2b A G 11: 91,575,988 S490P probably benign Het
Kxd1 A T 8: 70,519,939 N33K probably benign Het
Lrrk2 T C 15: 91,723,135 I567T probably benign Het
Man2a2 T C 7: 80,367,001 D355G probably damaging Het
Map6 T C 7: 99,268,107 V29A probably damaging Het
Mical3 A T 6: 121,033,710 V437D probably damaging Het
Mief1 T C 15: 80,249,740 Y333H probably benign Het
Olfr1303 A G 2: 111,814,253 F158L probably benign Het
Olfr533 T A 7: 140,466,519 V106D probably benign Het
Olfr917 A G 9: 38,665,620 S75P probably damaging Het
Olfr926 T C 9: 38,877,308 L44P possibly damaging Het
Pak1ip1 T A 13: 41,004,885 L78Q probably damaging Het
Pikfyve A G 1: 65,264,345 probably null Het
Pinlyp C T 7: 24,545,980 R5K possibly damaging Het
Pkd1l3 A G 8: 109,640,846 D1225G probably damaging Het
Pnmal2 T A 7: 16,946,568 S492R probably benign Het
Postn A G 3: 54,372,220 probably null Het
Ptprq A G 10: 107,580,266 Y1724H possibly damaging Het
Rpn2 T A 2: 157,310,188 probably null Het
Scn5a A G 9: 119,522,650 V755A probably damaging Het
Slc22a30 T C 19: 8,337,868 probably null Het
Specc1l T C 10: 75,248,632 S730P probably damaging Het
Steap2 T A 5: 5,675,891 I378F possibly damaging Het
Tdrd12 A T 7: 35,481,133 Y818* probably null Het
Thbs4 G T 13: 92,775,485 Q246K possibly damaging Het
Tnfsf10 A G 3: 27,335,549 Y253C probably damaging Het
Tnpo3 G T 6: 29,588,043 C125* probably null Het
Trim58 A G 11: 58,651,615 N467S probably benign Het
Trpm6 C T 19: 18,853,748 R1326* probably null Het
Zc3hav1l A G 6: 38,293,077 V279A probably benign Het
Zfp618 A T 4: 63,133,241 Q753L probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zkscan17 A T 11: 59,503,575 C67S probably damaging Het
Other mutations in Csrnp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Csrnp1 APN 9 119972958 missense probably damaging 1.00
IGL02348:Csrnp1 APN 9 119972643 missense probably damaging 1.00
R0463:Csrnp1 UTSW 9 119972775 unclassified probably benign
R1530:Csrnp1 UTSW 9 119973546 missense possibly damaging 0.69
R3901:Csrnp1 UTSW 9 119972641 missense probably damaging 1.00
R5851:Csrnp1 UTSW 9 119973078 missense possibly damaging 0.93
R7621:Csrnp1 UTSW 9 119977092 missense probably benign 0.12
R7658:Csrnp1 UTSW 9 119972403 missense probably benign
R8122:Csrnp1 UTSW 9 119973207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGATTATAGGCACACCC -3'
(R):5'- TGTGGAGCACAGTGTGTACC -3'

Sequencing Primer
(F):5'- CCCCTTATCTTACCCAGTCCGAC -3'
(R):5'- AGCACAGTGTGTACCCCTCC -3'
Posted On2017-08-16