Incidental Mutation 'R6101:Trim58'
ID485267
Institutional Source Beutler Lab
Gene Symbol Trim58
Ensembl Gene ENSMUSG00000037124
Gene Nametripartite motif-containing 58
SynonymsLOC386443, LOC216781
MMRRC Submission 044251-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R6101 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location58640465-58652404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58651615 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 467 (N467S)
Ref Sequence ENSEMBL: ENSMUSP00000074594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075084]
Predicted Effect probably benign
Transcript: ENSMUST00000075084
AA Change: N467S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000074594
Gene: ENSMUSG00000037124
AA Change: N467S

DomainStartEndE-ValueType
RING 15 58 2.95e-7 SMART
BBOX 90 131 2.93e-11 SMART
coiled coil region 192 241 N/A INTRINSIC
PRY 289 341 5.33e-23 SMART
SPRY 342 461 6.16e-29 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,970,759 C570S probably damaging Het
Adh6b T A 3: 138,357,710 I350K possibly damaging Het
Ahnak G A 19: 9,004,099 V916I probably benign Het
Aldh4a1 C T 4: 139,638,495 P266S possibly damaging Het
Arhgap11a G A 2: 113,834,874 R460* probably null Het
Chl1 A T 6: 103,693,032 D477V probably damaging Het
Clstn3 A T 6: 124,461,670 L45Q probably damaging Het
Cnot7 C T 8: 40,510,037 R32Q probably benign Het
Csrnp1 T C 9: 119,973,485 D220G probably damaging Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Glul T A 1: 153,906,431 Y137* probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Igha T A 12: 113,256,397 probably benign Het
Kif2b A G 11: 91,575,988 S490P probably benign Het
Kxd1 A T 8: 70,519,939 N33K probably benign Het
Lrrk2 T C 15: 91,723,135 I567T probably benign Het
Man2a2 T C 7: 80,367,001 D355G probably damaging Het
Map6 T C 7: 99,268,107 V29A probably damaging Het
Mical3 A T 6: 121,033,710 V437D probably damaging Het
Mief1 T C 15: 80,249,740 Y333H probably benign Het
Olfr1303 A G 2: 111,814,253 F158L probably benign Het
Olfr533 T A 7: 140,466,519 V106D probably benign Het
Olfr917 A G 9: 38,665,620 S75P probably damaging Het
Olfr926 T C 9: 38,877,308 L44P possibly damaging Het
Pak1ip1 T A 13: 41,004,885 L78Q probably damaging Het
Pikfyve A G 1: 65,264,345 probably null Het
Pinlyp C T 7: 24,545,980 R5K possibly damaging Het
Pkd1l3 A G 8: 109,640,846 D1225G probably damaging Het
Pnmal2 T A 7: 16,946,568 S492R probably benign Het
Postn A G 3: 54,372,220 probably null Het
Ptprq A G 10: 107,580,266 Y1724H possibly damaging Het
Rpn2 T A 2: 157,310,188 probably null Het
Scn5a A G 9: 119,522,650 V755A probably damaging Het
Slc22a30 T C 19: 8,337,868 probably null Het
Specc1l T C 10: 75,248,632 S730P probably damaging Het
Steap2 T A 5: 5,675,891 I378F possibly damaging Het
Tdrd12 A T 7: 35,481,133 Y818* probably null Het
Thbs4 G T 13: 92,775,485 Q246K possibly damaging Het
Tnfsf10 A G 3: 27,335,549 Y253C probably damaging Het
Tnpo3 G T 6: 29,588,043 C125* probably null Het
Trpm6 C T 19: 18,853,748 R1326* probably null Het
Zc3hav1l A G 6: 38,293,077 V279A probably benign Het
Zfp618 A T 4: 63,133,241 Q753L probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zkscan17 A T 11: 59,503,575 C67S probably damaging Het
Other mutations in Trim58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02351:Trim58 APN 11 58651350 missense probably damaging 1.00
IGL02358:Trim58 APN 11 58651350 missense probably damaging 1.00
IGL02792:Trim58 APN 11 58640466 utr 5 prime probably benign
IGL02794:Trim58 APN 11 58640466 utr 5 prime probably benign
IGL02875:Trim58 APN 11 58640466 utr 5 prime probably benign
IGL02934:Trim58 APN 11 58640466 utr 5 prime probably benign
IGL03083:Trim58 APN 11 58651390 missense probably benign 0.01
IGL03213:Trim58 APN 11 58651167 missense probably benign 0.00
R0011:Trim58 UTSW 11 58643120 missense probably benign 0.02
R0011:Trim58 UTSW 11 58643120 missense probably benign 0.02
R0735:Trim58 UTSW 11 58651393 missense probably benign 0.16
R1294:Trim58 UTSW 11 58643127 missense probably benign 0.28
R1929:Trim58 UTSW 11 58640667 missense possibly damaging 0.84
R2104:Trim58 UTSW 11 58643138 splice site probably benign
R2311:Trim58 UTSW 11 58643108 missense probably benign 0.02
R2981:Trim58 UTSW 11 58651561 missense probably damaging 1.00
R3432:Trim58 UTSW 11 58646961 splice site probably benign
R4270:Trim58 UTSW 11 58651267 missense probably damaging 1.00
R4450:Trim58 UTSW 11 58651365 missense probably benign 0.03
R4841:Trim58 UTSW 11 58651324 missense probably damaging 0.96
R4842:Trim58 UTSW 11 58651324 missense probably damaging 0.96
R5262:Trim58 UTSW 11 58651668 missense possibly damaging 0.88
R5979:Trim58 UTSW 11 58646083 missense probably damaging 1.00
R6684:Trim58 UTSW 11 58651620 missense probably benign 0.00
R6747:Trim58 UTSW 11 58651264 missense probably benign 0.02
R7126:Trim58 UTSW 11 58640579 missense probably damaging 1.00
R7981:Trim58 UTSW 11 58651312 missense probably benign 0.26
R8307:Trim58 UTSW 11 58647083 missense probably benign 0.00
X0026:Trim58 UTSW 11 58645969 missense probably damaging 1.00
X0067:Trim58 UTSW 11 58647105 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGCCTGTGCTCCAAGATGAG -3'
(R):5'- TCAGAATGTGAACCACCCG -3'

Sequencing Primer
(F):5'- TCCAAGATGAGCGACCTCG -3'
(R):5'- ACTCATCAGTCCCACTGGG -3'
Posted On2017-08-16