Mutagenetix > Incidental Mutation

Incidental Mutation 'R6101:Kif2b'

485269

Institutional Source

Beutler Lab

Gene Symbol

Kif2b

Ensembl Gene

ENSMUSG00000046755

Gene Name

kinesin family member 2B

Synonyms

1700063D03Rik

MMRRC Submission

044251-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.783) question?

Stock #

R6101 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

91575315-91577558 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 91575988 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 490 (S490P)

Ref Sequence

ENSEMBL: ENSMUSP00000058084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061019]

AlphaFold

Q8C0N1

Predicted Effect

probably benign
Transcript: ENSMUST00000061019
AA Change: S490P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000058084
Gene: ENSMUSG00000046755
AA Change: S490P

Domain	Start	End	E-Value	Type
low complexity region	55	70	N/A	INTRINSIC
low complexity region	90	103	N/A	INTRINSIC
low complexity region	151	176	N/A	INTRINSIC
KISc	211	549	2.34e-134	SMART
low complexity region	588	603	N/A	INTRINSIC
coiled coil region	640	664	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam9	A	T	8: 24,970,759	C570S	probably damaging	Het
Adh6b	T	A	3: 138,357,710	I350K	possibly damaging	Het
Ahnak	G	A	19: 9,004,099	V916I	probably benign	Het
Aldh4a1	C	T	4: 139,638,495	P266S	possibly damaging	Het
Arhgap11a	G	A	2: 113,834,874	R460*	probably null	Het
Chl1	A	T	6: 103,693,032	D477V	probably damaging	Het
Clstn3	A	T	6: 124,461,670	L45Q	probably damaging	Het
Cnot7	C	T	8: 40,510,037	R32Q	probably benign	Het
Csrnp1	T	C	9: 119,973,485	D220G	probably damaging	Het
Cyb5a	G	A	18: 84,871,593	R49Q	possibly damaging	Het
Fblim1	G	A	4: 141,584,722	R231C	probably damaging	Het
Glul	T	A	1: 153,906,431	Y137*	probably null	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Igha	T	A	12: 113,256,397		probably benign	Het
Kxd1	A	T	8: 70,519,939	N33K	probably benign	Het
Lrrk2	T	C	15: 91,723,135	I567T	probably benign	Het
Man2a2	T	C	7: 80,367,001	D355G	probably damaging	Het
Map6	T	C	7: 99,268,107	V29A	probably damaging	Het
Mical3	A	T	6: 121,033,710	V437D	probably damaging	Het
Mief1	T	C	15: 80,249,740	Y333H	probably benign	Het
Olfr1303	A	G	2: 111,814,253	F158L	probably benign	Het
Olfr533	T	A	7: 140,466,519	V106D	probably benign	Het
Olfr917	A	G	9: 38,665,620	S75P	probably damaging	Het
Olfr926	T	C	9: 38,877,308	L44P	possibly damaging	Het
Pak1ip1	T	A	13: 41,004,885	L78Q	probably damaging	Het
Pikfyve	A	G	1: 65,264,345		probably null	Het
Pinlyp	C	T	7: 24,545,980	R5K	possibly damaging	Het
Pkd1l3	A	G	8: 109,640,846	D1225G	probably damaging	Het
Pnmal2	T	A	7: 16,946,568	S492R	probably benign	Het
Postn	A	G	3: 54,372,220		probably null	Het
Ptprq	A	G	10: 107,580,266	Y1724H	possibly damaging	Het
Rpn2	T	A	2: 157,310,188		probably null	Het
Scn5a	A	G	9: 119,522,650	V755A	probably damaging	Het
Slc22a30	T	C	19: 8,337,868		probably null	Het
Specc1l	T	C	10: 75,248,632	S730P	probably damaging	Het
Steap2	T	A	5: 5,675,891	I378F	possibly damaging	Het
Tdrd12	A	T	7: 35,481,133	Y818*	probably null	Het
Thbs4	G	T	13: 92,775,485	Q246K	possibly damaging	Het
Tnfsf10	A	G	3: 27,335,549	Y253C	probably damaging	Het
Tnpo3	G	T	6: 29,588,043	C125*	probably null	Het
Trim58	A	G	11: 58,651,615	N467S	probably benign	Het
Trpm6	C	T	19: 18,853,748	R1326*	probably null	Het
Zc3hav1l	A	G	6: 38,293,077	V279A	probably benign	Het
Zfp618	A	T	4: 63,133,241	Q753L	probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het
Zkscan17	A	T	11: 59,503,575	C67S	probably damaging	Het

Other mutations in Kif2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00834:Kif2b	APN	11	91576380	missense	probably damaging	1.00
IGL01459:Kif2b	APN	11	91577023	missense	possibly damaging	0.65
IGL01468:Kif2b	APN	11	91576365	missense	probably damaging	1.00
IGL02897:Kif2b	APN	11	91576219	missense	probably damaging	1.00
R0076:Kif2b	UTSW	11	91575909	missense	probably damaging	1.00
R0488:Kif2b	UTSW	11	91576972	missense	probably benign	0.00
R0524:Kif2b	UTSW	11	91575724	missense	probably benign	0.00
R0549:Kif2b	UTSW	11	91576584	missense	probably damaging	1.00
R0893:Kif2b	UTSW	11	91575594	missense	probably benign	0.16
R1677:Kif2b	UTSW	11	91575972	missense	probably damaging	1.00
R2025:Kif2b	UTSW	11	91577346	missense	probably damaging	0.99
R2185:Kif2b	UTSW	11	91576971	frame shift	probably null
R2290:Kif2b	UTSW	11	91575696	missense	probably benign	0.00
R4697:Kif2b	UTSW	11	91576846	missense	probably benign	0.01
R4785:Kif2b	UTSW	11	91576428	missense	probably benign	0.07
R5429:Kif2b	UTSW	11	91577229	missense	probably benign	0.03
R5555:Kif2b	UTSW	11	91575460	missense	probably benign	0.00
R5652:Kif2b	UTSW	11	91575830	missense	possibly damaging	0.86
R5765:Kif2b	UTSW	11	91577242	missense	probably benign	0.28
R6105:Kif2b	UTSW	11	91575988	missense	probably benign	0.00
R6450:Kif2b	UTSW	11	91576366	missense	probably damaging	0.99
R6862:Kif2b	UTSW	11	91575915	missense	probably damaging	1.00
R7097:Kif2b	UTSW	11	91576824	missense	probably benign	0.00
R7189:Kif2b	UTSW	11	91577137	missense	probably benign	0.01
R7507:Kif2b	UTSW	11	91577443	missense	probably benign
R7742:Kif2b	UTSW	11	91576585	missense	possibly damaging	0.85
R7818:Kif2b	UTSW	11	91576126	missense	probably damaging	1.00
R7820:Kif2b	UTSW	11	91577274	missense	probably benign	0.01
R7946:Kif2b	UTSW	11	91575745	missense	probably benign	0.00
R8378:Kif2b	UTSW	11	91576375	missense	possibly damaging	0.95
R8442:Kif2b	UTSW	11	91576314	missense	possibly damaging	0.54
R8925:Kif2b	UTSW	11	91577197	missense	probably benign	0.00
R8927:Kif2b	UTSW	11	91577197	missense	probably benign	0.00
R8969:Kif2b	UTSW	11	91577193	missense	probably benign	0.00
R9002:Kif2b	UTSW	11	91576227	missense	probably benign	0.30
R9028:Kif2b	UTSW	11	91577185	missense	probably benign
R9039:Kif2b	UTSW	11	91576305	missense	possibly damaging	0.91
R9063:Kif2b	UTSW	11	91575828	missense	probably damaging	1.00
R9114:Kif2b	UTSW	11	91575712	missense	possibly damaging	0.77
R9279:Kif2b	UTSW	11	91577149	missense	probably benign	0.01
Z1176:Kif2b	UTSW	11	91576264	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CATCAGTGGTACCTCATGGC -3'
(R):5'- TCATTCTCAAGGCTGGAGGGAAG -3'

Sequencing Primer
(F):5'- ACACAGTGATGGTAGGGCCTTG -3'
(R):5'- AAGCTGCACGGCAAGTTTTC -3'

Posted On

2017-08-16