Mutagenetix > Incidental Mutations

Incidental Mutation 'R6101:Zfp647'

485273

Institutional Source

Beutler Lab

Gene Symbol

Zfp647

Ensembl Gene

ENSMUSG00000054967

Gene Name

zinc finger protein 647

Synonyms

MMRRC Submission

044251-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.109) question?

Stock #

R6101 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

76910371-76925448 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 76912085 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 125 (P125L)

Ref Sequence

ENSEMBL: ENSMUSP00000155272 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048854] [ENSMUST00000229055] [ENSMUST00000229865]

Predicted Effect

probably benign
Transcript: ENSMUST00000048854
AA Change: P125L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000041575
Gene: ENSMUSG00000054967
AA Change: P125L

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
KRAB	17	77	7.05e-33	SMART
ZnF_C2H2	174	196	3.39e-3	SMART
ZnF_C2H2	202	224	1.2e-3	SMART
ZnF_C2H2	230	252	2.95e-3	SMART
ZnF_C2H2	258	280	4.79e-3	SMART
ZnF_C2H2	286	308	1.84e-4	SMART
ZnF_C2H2	314	336	6.32e-3	SMART
ZnF_C2H2	342	364	7.37e-4	SMART
ZnF_C2H2	370	392	1.6e-4	SMART
ZnF_C2H2	398	420	2.2e-2	SMART
ZnF_C2H2	426	448	6.78e-3	SMART
ZnF_C2H2	454	476	4.87e-4	SMART
ZnF_C2H2	482	504	2.24e-3	SMART
ZnF_C2H2	510	532	9.08e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000229055
AA Change: P125L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

probably damaging
Transcript: ENSMUST00000229865
AA Change: P125L

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

Meta Mutation Damage Score

0.1789

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam9	A	T	8: 24,970,759	C570S	probably damaging	Het
Adh6b	T	A	3: 138,357,710	I350K	possibly damaging	Het
Ahnak	G	A	19: 9,004,099	V916I	probably benign	Het
Aldh4a1	C	T	4: 139,638,495	P266S	possibly damaging	Het
Arhgap11a	G	A	2: 113,834,874	R460*	probably null	Het
Chl1	A	T	6: 103,693,032	D477V	probably damaging	Het
Clstn3	A	T	6: 124,461,670	L45Q	probably damaging	Het
Cnot7	C	T	8: 40,510,037	R32Q	probably benign	Het
Csrnp1	T	C	9: 119,973,485	D220G	probably damaging	Het
Cyb5a	G	A	18: 84,871,593	R49Q	possibly damaging	Het
Fblim1	G	A	4: 141,584,722	R231C	probably damaging	Het
Glul	T	A	1: 153,906,431	Y137*	probably null	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Igha	T	A	12: 113,256,397		probably benign	Het
Kif2b	A	G	11: 91,575,988	S490P	probably benign	Het
Kxd1	A	T	8: 70,519,939	N33K	probably benign	Het
Lrrk2	T	C	15: 91,723,135	I567T	probably benign	Het
Man2a2	T	C	7: 80,367,001	D355G	probably damaging	Het
Map6	T	C	7: 99,268,107	V29A	probably damaging	Het
Mical3	A	T	6: 121,033,710	V437D	probably damaging	Het
Mief1	T	C	15: 80,249,740	Y333H	probably benign	Het
Olfr1303	A	G	2: 111,814,253	F158L	probably benign	Het
Olfr533	T	A	7: 140,466,519	V106D	probably benign	Het
Olfr917	A	G	9: 38,665,620	S75P	probably damaging	Het
Olfr926	T	C	9: 38,877,308	L44P	possibly damaging	Het
Pak1ip1	T	A	13: 41,004,885	L78Q	probably damaging	Het
Pikfyve	A	G	1: 65,264,345		probably null	Het
Pinlyp	C	T	7: 24,545,980	R5K	possibly damaging	Het
Pkd1l3	A	G	8: 109,640,846	D1225G	probably damaging	Het
Pnmal2	T	A	7: 16,946,568	S492R	probably benign	Het
Postn	A	G	3: 54,372,220		probably null	Het
Ptprq	A	G	10: 107,580,266	Y1724H	possibly damaging	Het
Rpn2	T	A	2: 157,310,188		probably null	Het
Scn5a	A	G	9: 119,522,650	V755A	probably damaging	Het
Slc22a30	T	C	19: 8,337,868		probably null	Het
Specc1l	T	C	10: 75,248,632	S730P	probably damaging	Het
Steap2	T	A	5: 5,675,891	I378F	possibly damaging	Het
Tdrd12	A	T	7: 35,481,133	Y818*	probably null	Het
Thbs4	G	T	13: 92,775,485	Q246K	possibly damaging	Het
Tnfsf10	A	G	3: 27,335,549	Y253C	probably damaging	Het
Tnpo3	G	T	6: 29,588,043	C125*	probably null	Het
Trim58	A	G	11: 58,651,615	N467S	probably benign	Het
Trpm6	C	T	19: 18,853,748	R1326*	probably null	Het
Zc3hav1l	A	G	6: 38,293,077	V279A	probably benign	Het
Zfp618	A	T	4: 63,133,241	Q753L	probably benign	Het
Zkscan17	A	T	11: 59,503,575	C67S	probably damaging	Het

Other mutations in Zfp647

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01565:Zfp647	APN	15	76911670	nonsense	probably null
IGL01680:Zfp647	APN	15	76917768	splice site	probably benign
IGL02647:Zfp647	APN	15	76917715	missense	probably damaging	1.00
IGL03213:Zfp647	APN	15	76911977	missense	possibly damaging	0.46
IGL03401:Zfp647	APN	15	76911368	missense	probably damaging	1.00
R0418:Zfp647	UTSW	15	76911386	missense	probably damaging	1.00
R1479:Zfp647	UTSW	15	76911203	missense	possibly damaging	0.94
R1913:Zfp647	UTSW	15	76911951	missense	probably benign	0.02
R1959:Zfp647	UTSW	15	76911114	missense	possibly damaging	0.57
R2176:Zfp647	UTSW	15	76911660	missense	probably damaging	1.00
R3076:Zfp647	UTSW	15	76918009	start codon destroyed	probably null
R3077:Zfp647	UTSW	15	76918009	start codon destroyed	probably null
R3701:Zfp647	UTSW	15	76910910	missense	probably damaging	1.00
R3702:Zfp647	UTSW	15	76910910	missense	probably damaging	1.00
R3960:Zfp647	UTSW	15	76910976	splice site	probably null
R4938:Zfp647	UTSW	15	76911044	frame shift	probably null
R4939:Zfp647	UTSW	15	76911044	frame shift	probably null
R5196:Zfp647	UTSW	15	76912085	missense	probably damaging	0.96
R5197:Zfp647	UTSW	15	76912085	missense	probably damaging	0.96
R5345:Zfp647	UTSW	15	76911495	missense	possibly damaging	0.48
R5415:Zfp647	UTSW	15	76911393	missense	possibly damaging	0.79
R5791:Zfp647	UTSW	15	76918006	missense	unknown
R5942:Zfp647	UTSW	15	76912085	missense	probably damaging	0.96
R5944:Zfp647	UTSW	15	76912085	missense	probably damaging	0.96
R5945:Zfp647	UTSW	15	76912085	missense	probably damaging	0.96
R5946:Zfp647	UTSW	15	76912085	missense	probably damaging	0.96
R5947:Zfp647	UTSW	15	76912085	missense	probably damaging	0.96
R6005:Zfp647	UTSW	15	76912085	missense	probably damaging	0.96
R6007:Zfp647	UTSW	15	76912085	missense	probably damaging	0.96
R6073:Zfp647	UTSW	15	76912085	missense	probably damaging	0.96
R6074:Zfp647	UTSW	15	76912085	missense	probably damaging	0.96
R6102:Zfp647	UTSW	15	76912085	missense	probably damaging	0.96
R6103:Zfp647	UTSW	15	76912085	missense	probably damaging	0.96
R6126:Zfp647	UTSW	15	76912085	missense	probably damaging	0.96
R6127:Zfp647	UTSW	15	76912085	missense	probably damaging	0.96
R6129:Zfp647	UTSW	15	76912085	missense	probably damaging	0.96
R6136:Zfp647	UTSW	15	76912085	missense	probably damaging	0.96
R6151:Zfp647	UTSW	15	76912085	missense	probably damaging	0.96
R6305:Zfp647	UTSW	15	76912085	missense	probably damaging	0.96
R6306:Zfp647	UTSW	15	76912085	missense	probably damaging	0.96
R6329:Zfp647	UTSW	15	76912085	missense	probably damaging	0.96
R6721:Zfp647	UTSW	15	76911876	missense	probably benign	0.00
R7158:Zfp647	UTSW	15	76917305	missense	probably benign	0.01
R7239:Zfp647	UTSW	15	76911756	missense	probably damaging	1.00
R7611:Zfp647	UTSW	15	76911788	missense	probably damaging	1.00
R8066:Zfp647	UTSW	15	76911895	missense	probably damaging	0.98
R8170:Zfp647	UTSW	15	76911371	missense	possibly damaging	0.87
R8346:Zfp647	UTSW	15	76911728	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACTTTCCACACTCAATGC -3'
(R):5'- ACTGTGAAGCAAAGCCAGC -3'

Sequencing Primer
(F):5'- CAGATATAGGGTCTCTCAACACTGG -3'
(R):5'- TTAAAGCAGCCCTTGTAGGTAGCC -3'

Posted On

2017-08-16