Incidental Mutation 'R6101:Cyb5a'
ID485277
Institutional Source Beutler Lab
Gene Symbol Cyb5a
Ensembl Gene ENSMUSG00000024646
Gene Namecytochrome b5 type A (microsomal)
SynonymsCyb5, 0610009N12Rik
MMRRC Submission 044251-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R6101 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location84851338-84880401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84871593 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 49 (R49Q)
Ref Sequence ENSEMBL: ENSMUSP00000124412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025549] [ENSMUST00000160180] [ENSMUST00000163083]
Predicted Effect probably benign
Transcript: ENSMUST00000025549
AA Change: R73Q

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025549
Gene: ENSMUSG00000024646
AA Change: R73Q

DomainStartEndE-ValueType
Cyt-b5 12 85 7.45e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159846
Predicted Effect possibly damaging
Transcript: ENSMUST00000160180
AA Change: R73Q

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124480
Gene: ENSMUSG00000024646
AA Change: R73Q

DomainStartEndE-ValueType
Cyt-b5 12 85 7.45e-28 SMART
transmembrane domain 109 131 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163083
AA Change: R49Q

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124412
Gene: ENSMUSG00000024646
AA Change: R49Q

DomainStartEndE-ValueType
Cyt-b5 1 61 1.66e-2 SMART
transmembrane domain 85 107 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound cytochrome that reduces ferric hemoglobin (methemoglobin) to ferrous hemoglobin, which is required for stearyl-CoA-desaturase activity. Defects in this gene are a cause of type IV hereditary methemoglobinemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a conditional allele exhibit abnormal pharmacokinetics of xenobiotics following cre-mediated recombination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,970,759 C570S probably damaging Het
Adh6b T A 3: 138,357,710 I350K possibly damaging Het
Ahnak G A 19: 9,004,099 V916I probably benign Het
Aldh4a1 C T 4: 139,638,495 P266S possibly damaging Het
Arhgap11a G A 2: 113,834,874 R460* probably null Het
Chl1 A T 6: 103,693,032 D477V probably damaging Het
Clstn3 A T 6: 124,461,670 L45Q probably damaging Het
Cnot7 C T 8: 40,510,037 R32Q probably benign Het
Csrnp1 T C 9: 119,973,485 D220G probably damaging Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Glul T A 1: 153,906,431 Y137* probably null Het
Gm10549 C A 18: 33,464,305 probably benign Het
Igha T A 12: 113,256,397 probably benign Het
Kif2b A G 11: 91,575,988 S490P probably benign Het
Kxd1 A T 8: 70,519,939 N33K probably benign Het
Lrrk2 T C 15: 91,723,135 I567T probably benign Het
Man2a2 T C 7: 80,367,001 D355G probably damaging Het
Map6 T C 7: 99,268,107 V29A probably damaging Het
Mical3 A T 6: 121,033,710 V437D probably damaging Het
Mief1 T C 15: 80,249,740 Y333H probably benign Het
Olfr1303 A G 2: 111,814,253 F158L probably benign Het
Olfr533 T A 7: 140,466,519 V106D probably benign Het
Olfr917 A G 9: 38,665,620 S75P probably damaging Het
Olfr926 T C 9: 38,877,308 L44P possibly damaging Het
Pak1ip1 T A 13: 41,004,885 L78Q probably damaging Het
Pikfyve A G 1: 65,264,345 probably null Het
Pinlyp C T 7: 24,545,980 R5K possibly damaging Het
Pkd1l3 A G 8: 109,640,846 D1225G probably damaging Het
Pnmal2 T A 7: 16,946,568 S492R probably benign Het
Postn A G 3: 54,372,220 probably null Het
Ptprq A G 10: 107,580,266 Y1724H possibly damaging Het
Rpn2 T A 2: 157,310,188 probably null Het
Scn5a A G 9: 119,522,650 V755A probably damaging Het
Slc22a30 T C 19: 8,337,868 probably null Het
Specc1l T C 10: 75,248,632 S730P probably damaging Het
Steap2 T A 5: 5,675,891 I378F possibly damaging Het
Tdrd12 A T 7: 35,481,133 Y818* probably null Het
Thbs4 G T 13: 92,775,485 Q246K possibly damaging Het
Tnfsf10 A G 3: 27,335,549 Y253C probably damaging Het
Tnpo3 G T 6: 29,588,043 C125* probably null Het
Trim58 A G 11: 58,651,615 N467S probably benign Het
Trpm6 C T 19: 18,853,748 R1326* probably null Het
Zc3hav1l A G 6: 38,293,077 V279A probably benign Het
Zfp618 A T 4: 63,133,241 Q753L probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zkscan17 A T 11: 59,503,575 C67S probably damaging Het
Other mutations in Cyb5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Cyb5a APN 18 84879523 missense probably damaging 0.99
IGL01404:Cyb5a APN 18 84877860 missense probably benign 0.13
IGL02152:Cyb5a APN 18 84873156 missense probably benign 0.04
IGL02179:Cyb5a APN 18 84873155 missense probably benign 0.01
IGL02561:Cyb5a APN 18 84871512 missense probably damaging 1.00
IGL02590:Cyb5a APN 18 84871607 missense probably benign 0.01
R0011:Cyb5a UTSW 18 84877822 splice site probably benign
R1122:Cyb5a UTSW 18 84877839 missense possibly damaging 0.62
R1495:Cyb5a UTSW 18 84851480 start codon destroyed probably null 0.99
R1796:Cyb5a UTSW 18 84851561 missense probably benign 0.05
R4402:Cyb5a UTSW 18 84871593 missense possibly damaging 0.87
R5237:Cyb5a UTSW 18 84871564 missense probably damaging 1.00
R6105:Cyb5a UTSW 18 84871593 missense possibly damaging 0.87
R6771:Cyb5a UTSW 18 84871630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTGGGCTATCTGATCAG -3'
(R):5'- CCCCGAGTTCAGCAATAACTG -3'

Sequencing Primer
(F):5'- TGGGCTATCTGATCAGATAAGC -3'
(R):5'- AGGTATCCTGTTAAGCACCG -3'
Posted On2017-08-16