Incidental Mutation 'R6102:Rsrc1'
ID485292
Institutional Source Beutler Lab
Gene Symbol Rsrc1
Ensembl Gene ENSMUSG00000034544
Gene Namearginine/serine-rich coiled-coil 1
Synonyms1200013F24Rik, SRrp53
MMRRC Submission 044252-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R6102 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location66981390-67358396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66994649 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 44 (P44L)
Ref Sequence ENSEMBL: ENSMUSP00000125547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046542] [ENSMUST00000065047] [ENSMUST00000065074] [ENSMUST00000160504] [ENSMUST00000161726] [ENSMUST00000162036] [ENSMUST00000162362] [ENSMUST00000162693]
Predicted Effect unknown
Transcript: ENSMUST00000046542
AA Change: P44L
SMART Domains Protein: ENSMUSP00000047077
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 116 N/A INTRINSIC
coiled coil region 138 191 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000065047
AA Change: P44L
SMART Domains Protein: ENSMUSP00000066967
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 109 N/A INTRINSIC
coiled coil region 122 175 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000065074
AA Change: P44L
SMART Domains Protein: ENSMUSP00000066797
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 95 N/A INTRINSIC
low complexity region 98 159 N/A INTRINSIC
coiled coil region 180 233 N/A INTRINSIC
low complexity region 265 278 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000160504
AA Change: P44L
SMART Domains Protein: ENSMUSP00000124925
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 59 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161726
AA Change: P44L
SMART Domains Protein: ENSMUSP00000124347
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 95 N/A INTRINSIC
low complexity region 98 159 N/A INTRINSIC
coiled coil region 180 233 N/A INTRINSIC
low complexity region 265 278 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162036
AA Change: P44L
SMART Domains Protein: ENSMUSP00000125468
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 95 N/A INTRINSIC
low complexity region 98 159 N/A INTRINSIC
coiled coil region 180 233 N/A INTRINSIC
low complexity region 265 278 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162362
AA Change: P44L
SMART Domains Protein: ENSMUSP00000123699
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 59 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162620
Predicted Effect unknown
Transcript: ENSMUST00000162693
AA Change: P44L
SMART Domains Protein: ENSMUSP00000125547
Gene: ENSMUSG00000034544
AA Change: P44L

DomainStartEndE-ValueType
low complexity region 3 88 N/A INTRINSIC
low complexity region 96 157 N/A INTRINSIC
coiled coil region 178 231 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182708
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine and arginine rich-related protein family. The encoded protein is involved in both constitutive and alternative mRNA splicing. This gene may be associated with schizophrenia. A pseudogene of this gene is located on chromosome 9. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,320,023 I290T possibly damaging Het
Apeh T A 9: 108,086,439 D559V probably damaging Het
Aspm T A 1: 139,477,459 Y1361* probably null Het
Atad5 G T 11: 80,111,572 probably null Het
Ccr4 C T 9: 114,496,493 probably null Het
Clasrp G A 7: 19,586,468 probably benign Het
Cldn23 A G 8: 35,825,551 M261T probably benign Het
Cmya5 T C 13: 93,094,231 M1450V probably benign Het
Cyp4v3 T A 8: 45,320,160 E202V probably damaging Het
Dnah7a A T 1: 53,559,140 V1412E probably benign Het
Dnah9 A G 11: 65,990,516 S2578P probably damaging Het
Dsc2 T A 18: 20,047,108 Y196F probably benign Het
Exoc1 T C 5: 76,537,779 S113P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Frs3 C T 17: 47,702,671 H173Y probably damaging Het
Ginm1 G T 10: 7,768,496 T323K probably benign Het
Golgb1 T C 16: 36,912,865 S825P probably damaging Het
Hs3st3b1 A T 11: 63,921,855 C11* probably null Het
Ighv3-3 G C 12: 114,196,460 A110G possibly damaging Het
Igkv6-20 G A 6: 70,335,869 H107Y probably benign Het
Kcnj16 A G 11: 111,025,577 E355G probably benign Het
Lig4 C T 8: 9,972,872 G303S probably damaging Het
Map1b A C 13: 99,425,873 V2443G unknown Het
Map3k6 T C 4: 133,247,131 probably null Het
Mmp13 A G 9: 7,276,688 Q261R probably benign Het
Mphosph9 T A 5: 124,297,709 I554F possibly damaging Het
Mrgpra3 A T 7: 47,590,149 F10I possibly damaging Het
Ms4a18 G A 19: 11,013,523 T69I probably benign Het
Mtmr3 T C 11: 4,487,673 N927S probably damaging Het
Necab1 T A 4: 14,989,211 Q188L probably benign Het
Nfatc2 A G 2: 168,519,507 probably benign Het
Olfr152 T C 2: 87,782,848 F103L probably damaging Het
Olfr495 T C 7: 108,395,284 S55P probably damaging Het
Olfr854 T C 9: 19,567,022 M121V possibly damaging Het
Paip2b A C 6: 83,808,846 V134G possibly damaging Het
Pax3 T C 1: 78,132,347 T225A probably damaging Het
Pbx1 C A 1: 168,183,565 A298S probably benign Het
Pcdhac2 A T 18: 37,146,282 K772* probably null Het
Pcsk4 A T 10: 80,325,817 Y163* probably null Het
Plcd3 A G 11: 103,080,644 V58A probably damaging Het
Plek2 T A 12: 78,900,093 T57S possibly damaging Het
Plscr2 C T 9: 92,287,668 T57I probably benign Het
Ppp2r5b A G 19: 6,234,738 S32P probably benign Het
Ppp3r2 C T 4: 49,682,022 probably benign Het
Psme4 T A 11: 30,865,567 L1693H probably damaging Het
Rrbp1 T A 2: 143,988,393 Q618L probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Serpina3b A T 12: 104,134,169 T337S probably benign Het
Slc18a2 T C 19: 59,293,878 Y506H probably benign Het
Slc9a9 A G 9: 94,936,429 Y292C probably benign Het
Spta1 T C 1: 174,224,520 V1840A probably benign Het
Ssb T C 2: 69,871,208 *416Q probably null Het
Strada A G 11: 106,168,436 V209A probably benign Het
Tbc1d31 A T 15: 57,936,093 D225V probably damaging Het
Tgm4 T C 9: 123,056,535 F381L probably benign Het
Tmem120b T A 5: 123,115,144 Y203N probably damaging Het
Tmem176b A G 6: 48,835,934 V109A probably benign Het
Tnfrsf11a C A 1: 105,819,946 L201M possibly damaging Het
Ttn C A 2: 76,974,350 probably null Het
Tubb2a T C 13: 34,075,343 I155V probably benign Het
Vmn1r5 A G 6: 56,986,114 D258G probably damaging Het
Vmn2r121 T C X: 124,133,575 T120A probably benign Het
Vmn2r19 A T 6: 123,329,948 I472F probably damaging Het
Vwa3a A G 7: 120,776,138 probably null Het
Zfp273 A G 13: 67,822,347 Y5C probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp825 A G 13: 74,480,653 L248P probably damaging Het
Other mutations in Rsrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Rsrc1 APN 3 67082600 intron probably benign
IGL03180:Rsrc1 APN 3 67082543 intron probably benign
R0200:Rsrc1 UTSW 3 67180861 missense probably damaging 0.99
R0463:Rsrc1 UTSW 3 67180861 missense probably damaging 0.99
R1175:Rsrc1 UTSW 3 67356218 splice site probably benign
R1293:Rsrc1 UTSW 3 67356279 missense probably damaging 1.00
R1677:Rsrc1 UTSW 3 67355475 missense probably damaging 0.97
R1981:Rsrc1 UTSW 3 67350005 missense probably benign 0.18
R2039:Rsrc1 UTSW 3 66994618 missense unknown
R4222:Rsrc1 UTSW 3 66994567 missense unknown
R4624:Rsrc1 UTSW 3 67349978 missense probably damaging 1.00
R4852:Rsrc1 UTSW 3 67355602 missense probably damaging 1.00
R6103:Rsrc1 UTSW 3 66994649 missense unknown
R6104:Rsrc1 UTSW 3 66994649 missense unknown
R6127:Rsrc1 UTSW 3 66994649 missense unknown
R6129:Rsrc1 UTSW 3 66994649 missense unknown
R6153:Rsrc1 UTSW 3 67355562 missense probably benign 0.33
R6409:Rsrc1 UTSW 3 66994649 missense unknown
R6410:Rsrc1 UTSW 3 66994649 missense unknown
R6411:Rsrc1 UTSW 3 66994649 missense unknown
R6412:Rsrc1 UTSW 3 66994649 missense unknown
R6422:Rsrc1 UTSW 3 66994649 missense unknown
R6424:Rsrc1 UTSW 3 66994649 missense unknown
R6442:Rsrc1 UTSW 3 66994649 missense unknown
R6487:Rsrc1 UTSW 3 66994649 missense unknown
R6899:Rsrc1 UTSW 3 66994649 missense unknown
R6910:Rsrc1 UTSW 3 66994649 missense unknown
R6911:Rsrc1 UTSW 3 66994649 missense unknown
R6912:Rsrc1 UTSW 3 66994649 missense unknown
R6916:Rsrc1 UTSW 3 66994649 missense unknown
R6917:Rsrc1 UTSW 3 66994649 missense unknown
R6930:Rsrc1 UTSW 3 66994649 missense unknown
R6931:Rsrc1 UTSW 3 66994649 missense unknown
R6994:Rsrc1 UTSW 3 66994649 missense unknown
R6995:Rsrc1 UTSW 3 66994649 missense unknown
R6997:Rsrc1 UTSW 3 66994649 missense unknown
R7010:Rsrc1 UTSW 3 66994649 missense unknown
R7015:Rsrc1 UTSW 3 66994649 missense unknown
R7048:Rsrc1 UTSW 3 67180831 missense probably damaging 0.99
R7078:Rsrc1 UTSW 3 66994654 missense unknown
Z1176:Rsrc1 UTSW 3 67349982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCCAAGCACATGTTAGTTT -3'
(R):5'- GCTTTTGGGAGAAAGGTTGC -3'

Posted On2017-08-16