Incidental Mutation 'R6102:Tmem120b'
ID 485298
Institutional Source Beutler Lab
Gene Symbol Tmem120b
Ensembl Gene ENSMUSG00000054434
Gene Name transmembrane protein 120B
Synonyms
MMRRC Submission 044252-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.095) question?
Stock # R6102 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 123214329-123256276 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 123253207 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 203 (Y203N)
Ref Sequence ENSEMBL: ENSMUSP00000107246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031401] [ENSMUST00000067505] [ENSMUST00000111619] [ENSMUST00000160344] [ENSMUST00000160479] [ENSMUST00000161059] [ENSMUST00000186469]
AlphaFold Q3TA38
Predicted Effect probably benign
Transcript: ENSMUST00000031401
SMART Domains Protein: ENSMUSP00000031401
Gene: ENSMUSG00000029449

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
RHO 22 195 1.5e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000067505
AA Change: Y242N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000068551
Gene: ENSMUSG00000054434
AA Change: Y242N

DomainStartEndE-ValueType
Pfam:TMPIT 9 332 1.9e-158 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111619
AA Change: Y203N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107246
Gene: ENSMUSG00000054434
AA Change: Y203N

DomainStartEndE-ValueType
Pfam:TMPIT 7 64 1.3e-14 PFAM
Pfam:TMPIT 60 298 1.3e-127 PFAM
Predicted Effect silent
Transcript: ENSMUST00000160344
SMART Domains Protein: ENSMUSP00000124971
Gene: ENSMUSG00000054434

DomainStartEndE-ValueType
Pfam:TMPIT 7 64 4.1e-16 PFAM
Pfam:TMPIT 62 120 1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160479
SMART Domains Protein: ENSMUSP00000124866
Gene: ENSMUSG00000029449

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
RHO 22 195 1.5e-98 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161049
Predicted Effect probably benign
Transcript: ENSMUST00000161059
SMART Domains Protein: ENSMUSP00000124358
Gene: ENSMUSG00000054434

DomainStartEndE-ValueType
Pfam:TMPIT 7 106 3.2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200411
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162208
Predicted Effect probably benign
Transcript: ENSMUST00000186469
SMART Domains Protein: ENSMUSP00000140177
Gene: ENSMUSG00000029449

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
RHO 22 195 1.5e-98 SMART
Meta Mutation Damage Score 0.9628 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 97% (65/67)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,210,849 (GRCm39) I290T possibly damaging Het
Apeh T A 9: 107,963,638 (GRCm39) D559V probably damaging Het
Aspm T A 1: 139,405,197 (GRCm39) Y1361* probably null Het
Atad5 G T 11: 80,002,398 (GRCm39) probably null Het
Ccr4 C T 9: 114,325,561 (GRCm39) probably null Het
Clasrp G A 7: 19,320,393 (GRCm39) probably benign Het
Cldn23 A G 8: 36,292,705 (GRCm39) M261T probably benign Het
Cmya5 T C 13: 93,230,739 (GRCm39) M1450V probably benign Het
Cyp4v3 T A 8: 45,773,197 (GRCm39) E202V probably damaging Het
Dnah7a A T 1: 53,598,299 (GRCm39) V1412E probably benign Het
Dnah9 A G 11: 65,881,342 (GRCm39) S2578P probably damaging Het
Dsc2 T A 18: 20,180,165 (GRCm39) Y196F probably benign Het
Exoc1 T C 5: 76,685,626 (GRCm39) S113P probably damaging Het
Fbxo6 A T 4: 148,233,979 (GRCm39) I39N probably damaging Het
Frs3 C T 17: 48,013,596 (GRCm39) H173Y probably damaging Het
Ginm1 G T 10: 7,644,260 (GRCm39) T323K probably benign Het
Golgb1 T C 16: 36,733,227 (GRCm39) S825P probably damaging Het
Hs3st3b1 A T 11: 63,812,681 (GRCm39) C11* probably null Het
Ighv3-3 G C 12: 114,160,080 (GRCm39) A110G possibly damaging Het
Igkv6-20 G A 6: 70,312,853 (GRCm39) H107Y probably benign Het
Kcnj16 A G 11: 110,916,403 (GRCm39) E355G probably benign Het
Lig4 C T 8: 10,022,872 (GRCm39) G303S probably damaging Het
Map1b A C 13: 99,562,381 (GRCm39) V2443G unknown Het
Map3k6 T C 4: 132,974,442 (GRCm39) probably null Het
Mmp13 A G 9: 7,276,688 (GRCm39) Q261R probably benign Het
Mphosph9 T A 5: 124,435,772 (GRCm39) I554F possibly damaging Het
Mrgpra3 A T 7: 47,239,897 (GRCm39) F10I possibly damaging Het
Ms4a18 G A 19: 10,990,887 (GRCm39) T69I probably benign Het
Mtmr3 T C 11: 4,437,673 (GRCm39) N927S probably damaging Het
Necab1 T A 4: 14,989,211 (GRCm39) Q188L probably benign Het
Nfatc2 A G 2: 168,361,427 (GRCm39) probably benign Het
Or5i1 T C 2: 87,613,192 (GRCm39) F103L probably damaging Het
Or5p70 T C 7: 107,994,491 (GRCm39) S55P probably damaging Het
Or7g34 T C 9: 19,478,318 (GRCm39) M121V possibly damaging Het
Paip2b A C 6: 83,785,828 (GRCm39) V134G possibly damaging Het
Pax3 T C 1: 78,108,984 (GRCm39) T225A probably damaging Het
Pbx1 C A 1: 168,011,134 (GRCm39) A298S probably benign Het
Pcdhac2 A T 18: 37,279,335 (GRCm39) K772* probably null Het
Pcsk4 A T 10: 80,161,651 (GRCm39) Y163* probably null Het
Plcd3 A G 11: 102,971,470 (GRCm39) V58A probably damaging Het
Plek2 T A 12: 78,946,867 (GRCm39) T57S possibly damaging Het
Plscr2 C T 9: 92,169,721 (GRCm39) T57I probably benign Het
Ppp2r5b A G 19: 6,284,768 (GRCm39) S32P probably benign Het
Ppp3r2 C T 4: 49,682,022 (GRCm39) probably benign Het
Psme4 T A 11: 30,815,567 (GRCm39) L1693H probably damaging Het
Rrbp1 T A 2: 143,830,313 (GRCm39) Q618L probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Serpina3b A T 12: 104,100,428 (GRCm39) T337S probably benign Het
Slc18a2 T C 19: 59,282,310 (GRCm39) Y506H probably benign Het
Slc9a9 A G 9: 94,818,482 (GRCm39) Y292C probably benign Het
Spta1 T C 1: 174,052,086 (GRCm39) V1840A probably benign Het
Ssb T C 2: 69,701,552 (GRCm39) *416Q probably null Het
Strada A G 11: 106,059,262 (GRCm39) V209A probably benign Het
Tbc1d31 A T 15: 57,799,489 (GRCm39) D225V probably damaging Het
Tgm4 T C 9: 122,885,600 (GRCm39) F381L probably benign Het
Tmem176b A G 6: 48,812,868 (GRCm39) V109A probably benign Het
Tnfrsf11a C A 1: 105,747,671 (GRCm39) L201M possibly damaging Het
Ttn C A 2: 76,804,694 (GRCm39) probably null Het
Tubb2a T C 13: 34,259,326 (GRCm39) I155V probably benign Het
Vmn1r5 A G 6: 56,963,099 (GRCm39) D258G probably damaging Het
Vmn2r121 T C X: 123,043,272 (GRCm39) T120A probably benign Het
Vmn2r19 A T 6: 123,306,907 (GRCm39) I472F probably damaging Het
Vwa3a A G 7: 120,375,361 (GRCm39) probably null Het
Zfp273 A G 13: 67,970,466 (GRCm39) Y5C probably damaging Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Zfp825 A G 13: 74,628,772 (GRCm39) L248P probably damaging Het
Other mutations in Tmem120b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Tmem120b APN 5 123,253,229 (GRCm39) splice site probably null
IGL00334:Tmem120b APN 5 123,253,230 (GRCm39) missense probably damaging 0.99
IGL03064:Tmem120b APN 5 123,240,336 (GRCm39) missense possibly damaging 0.74
altogether UTSW 5 123,254,302 (GRCm39) missense probably damaging 1.00
R3176:Tmem120b UTSW 5 123,252,167 (GRCm39) missense probably damaging 1.00
R3276:Tmem120b UTSW 5 123,252,167 (GRCm39) missense probably damaging 1.00
R5603:Tmem120b UTSW 5 123,239,705 (GRCm39) missense possibly damaging 0.78
R5990:Tmem120b UTSW 5 123,242,544 (GRCm39) missense probably damaging 1.00
R6264:Tmem120b UTSW 5 123,253,763 (GRCm39) missense probably damaging 1.00
R6577:Tmem120b UTSW 5 123,254,710 (GRCm39) missense probably damaging 0.98
R6936:Tmem120b UTSW 5 123,254,287 (GRCm39) missense possibly damaging 0.81
R7114:Tmem120b UTSW 5 123,254,741 (GRCm39) missense probably damaging 1.00
R8169:Tmem120b UTSW 5 123,237,999 (GRCm39) nonsense probably null
R8893:Tmem120b UTSW 5 123,254,302 (GRCm39) missense probably damaging 1.00
R9067:Tmem120b UTSW 5 123,236,307 (GRCm39) missense probably damaging 1.00
R9159:Tmem120b UTSW 5 123,242,566 (GRCm39) missense possibly damaging 0.89
R9659:Tmem120b UTSW 5 123,253,788 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGGCAGTCACATAGATGTATAG -3'
(R):5'- CAATTATGAGCAGCCAGTGGG -3'

Sequencing Primer
(F):5'- TCAAAGTTGAAGCTGGTCACC -3'
(R):5'- CAGTGGGTGAAGAATATCAGCTTCTC -3'
Posted On 2017-08-16