Incidental Mutation 'R6102:Cldn23'
ID485311
Institutional Source Beutler Lab
Gene Symbol Cldn23
Ensembl Gene ENSMUSG00000055976
Gene Nameclaudin 23
Synonyms
MMRRC Submission 044252-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R6102 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location35824712-35826559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35825551 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 261 (M261T)
Ref Sequence ENSEMBL: ENSMUSP00000049725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060128]
Predicted Effect probably benign
Transcript: ENSMUST00000060128
AA Change: M261T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000049725
Gene: ENSMUSG00000055976
AA Change: M261T

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 3 177 6e-19 PFAM
low complexity region 273 284 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000210370
AA Change: M8T
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is intronless and the protein encoded by this gene is 77% identical to the human homolog. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,320,023 I290T possibly damaging Het
Apeh T A 9: 108,086,439 D559V probably damaging Het
Aspm T A 1: 139,477,459 Y1361* probably null Het
Atad5 G T 11: 80,111,572 probably null Het
Ccr4 C T 9: 114,496,493 probably null Het
Clasrp G A 7: 19,586,468 probably benign Het
Cmya5 T C 13: 93,094,231 M1450V probably benign Het
Cyp4v3 T A 8: 45,320,160 E202V probably damaging Het
Dnah7a A T 1: 53,559,140 V1412E probably benign Het
Dnah9 A G 11: 65,990,516 S2578P probably damaging Het
Dsc2 T A 18: 20,047,108 Y196F probably benign Het
Exoc1 T C 5: 76,537,779 S113P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Frs3 C T 17: 47,702,671 H173Y probably damaging Het
Ginm1 G T 10: 7,768,496 T323K probably benign Het
Golgb1 T C 16: 36,912,865 S825P probably damaging Het
Hs3st3b1 A T 11: 63,921,855 C11* probably null Het
Ighv3-3 G C 12: 114,196,460 A110G possibly damaging Het
Igkv6-20 G A 6: 70,335,869 H107Y probably benign Het
Kcnj16 A G 11: 111,025,577 E355G probably benign Het
Lig4 C T 8: 9,972,872 G303S probably damaging Het
Map1b A C 13: 99,425,873 V2443G unknown Het
Map3k6 T C 4: 133,247,131 probably null Het
Mmp13 A G 9: 7,276,688 Q261R probably benign Het
Mphosph9 T A 5: 124,297,709 I554F possibly damaging Het
Mrgpra3 A T 7: 47,590,149 F10I possibly damaging Het
Ms4a18 G A 19: 11,013,523 T69I probably benign Het
Mtmr3 T C 11: 4,487,673 N927S probably damaging Het
Necab1 T A 4: 14,989,211 Q188L probably benign Het
Nfatc2 A G 2: 168,519,507 probably benign Het
Olfr152 T C 2: 87,782,848 F103L probably damaging Het
Olfr495 T C 7: 108,395,284 S55P probably damaging Het
Olfr854 T C 9: 19,567,022 M121V possibly damaging Het
Paip2b A C 6: 83,808,846 V134G possibly damaging Het
Pax3 T C 1: 78,132,347 T225A probably damaging Het
Pbx1 C A 1: 168,183,565 A298S probably benign Het
Pcdhac2 A T 18: 37,146,282 K772* probably null Het
Pcsk4 A T 10: 80,325,817 Y163* probably null Het
Plcd3 A G 11: 103,080,644 V58A probably damaging Het
Plek2 T A 12: 78,900,093 T57S possibly damaging Het
Plscr2 C T 9: 92,287,668 T57I probably benign Het
Ppp2r5b A G 19: 6,234,738 S32P probably benign Het
Ppp3r2 C T 4: 49,682,022 probably benign Het
Psme4 T A 11: 30,865,567 L1693H probably damaging Het
Rrbp1 T A 2: 143,988,393 Q618L probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Serpina3b A T 12: 104,134,169 T337S probably benign Het
Slc18a2 T C 19: 59,293,878 Y506H probably benign Het
Slc9a9 A G 9: 94,936,429 Y292C probably benign Het
Spta1 T C 1: 174,224,520 V1840A probably benign Het
Ssb T C 2: 69,871,208 *416Q probably null Het
Strada A G 11: 106,168,436 V209A probably benign Het
Tbc1d31 A T 15: 57,936,093 D225V probably damaging Het
Tgm4 T C 9: 123,056,535 F381L probably benign Het
Tmem120b T A 5: 123,115,144 Y203N probably damaging Het
Tmem176b A G 6: 48,835,934 V109A probably benign Het
Tnfrsf11a C A 1: 105,819,946 L201M possibly damaging Het
Ttn C A 2: 76,974,350 probably null Het
Tubb2a T C 13: 34,075,343 I155V probably benign Het
Vmn1r5 A G 6: 56,986,114 D258G probably damaging Het
Vmn2r121 T C X: 124,133,575 T120A probably benign Het
Vmn2r19 A T 6: 123,329,948 I472F probably damaging Het
Vwa3a A G 7: 120,776,138 probably null Het
Zfp273 A G 13: 67,822,347 Y5C probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp825 A G 13: 74,480,653 L248P probably damaging Het
Other mutations in Cldn23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Cldn23 APN 8 35825920 missense possibly damaging 0.81
IGL01767:Cldn23 APN 8 35825662 missense probably damaging 1.00
IGL02078:Cldn23 APN 8 35826205 missense possibly damaging 0.94
IGL03346:Cldn23 APN 8 35825440 intron probably benign
R1610:Cldn23 UTSW 8 35825930 missense probably damaging 1.00
R1753:Cldn23 UTSW 8 35825986 missense possibly damaging 0.94
R1915:Cldn23 UTSW 8 35825945 missense possibly damaging 0.69
R2121:Cldn23 UTSW 8 35826235 missense probably benign
R4342:Cldn23 UTSW 8 35825498 missense probably benign 0.00
R5167:Cldn23 UTSW 8 35826320 missense possibly damaging 0.89
R5207:Cldn23 UTSW 8 35826028 missense probably damaging 1.00
R7106:Cldn23 UTSW 8 35825915 missense probably benign
R7363:Cldn23 UTSW 8 35825505 critical splice donor site probably null
R7721:Cldn23 UTSW 8 35826263 missense possibly damaging 0.89
R8119:Cldn23 UTSW 8 35825902 missense probably damaging 0.99
Z1176:Cldn23 UTSW 8 35826277 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCAGATGTACTGGCAGAAGTTC -3'
(R):5'- TCTTGTCAGATCCCGACGTC -3'

Sequencing Primer
(F):5'- TGTACTGGCAGAAGTTCAAGTCACC -3'
(R):5'- AGGTCAGCTACAGCCTGGTG -3'
Posted On2017-08-16